Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:18400

Mettl22 methyltransferase like 22 ( MGI:2384301)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:18400 EMAGE:18400 EMAGE:18400 EMAGE:18400 EMAGE:18400
"Pseudo-wholemount" of euxassay_014351. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_014351_01 euxassay_014351_02 euxassay_014351_03 euxassay_014351_04
EMAGE:18400 EMAGE:18400 EMAGE:18400 EMAGE:18400 EMAGE:18400
euxassay_014351_05 euxassay_014351_06 euxassay_014351_07 euxassay_014351_08 euxassay_014351_09
EMAGE:18400 EMAGE:18400 EMAGE:18400 EMAGE:18400 EMAGE:18400
euxassay_014351_10 euxassay_014351_11 euxassay_014351_12 euxassay_014351_13 euxassay_014351_14
EMAGE:18400 EMAGE:18400 EMAGE:18400 EMAGE:18400 EMAGE:18400
euxassay_014351_15 euxassay_014351_16 euxassay_014351_17 euxassay_014351_18 euxassay_014351_19
EMAGE:18400 EMAGE:18400 EMAGE:18400 EMAGE:18400
euxassay_014351_20 euxassay_014351_21 euxassay_014351_22 euxassay_014351_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:18400Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
18400_wholemount_strong.wlz
18400_wholemount_moderate.wlz
18400_wholemount_weak.wlz
18400_wholemount_possible.wlz
18400_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:18400_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
rib
strong strong
regionalstrong expression: see section 02 moderate expression: see section 15 16 17 18 weak expression: see section 04 05 07 08 19 20 21 22 23
radius
strong strong
regionalstrong expression: see section 01 02
ulna
strong strong
regionalstrong expression: see section 01
humerus
strong strong
regionalstrong expression: see section 01 02 04 05 06 21 22 23
hindlimb digit 2 metatarsal
moderate moderate
regionalmoderate expression: see section 23
hindlimb digit 2 phalanx
strong strong
regionalstrong expression: see section 07 moderate expression: see section 22 23
hindlimb digit 3 metatarsal
moderate moderate
regionalmoderate expression: see section 23
hindlimb digit 3 phalanx
strong strong
regionalstrong expression: see section 07 moderate expression: see section 22 23
hindlimb digit 4 phalanx
strong strong
regionalstrong expression: see section 07 moderate expression: see section 22
tarsus
moderate moderate
regionalmoderate expression: see section 23
fibula
strong strong
regionalstrong expression: see section 01 02 03
tibia
strong strong
regionalstrong expression: see section 01 02 03 04
femur
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 17 18 19 20 moderate expression: see section 22 23
otic capsule
strong strong
regionalstrong expression: see section 09 10 15 16 moderate expression: see section 06 07 08 17
nasal septum
strong strong
regionalstrong expression: see section 14
viscerocranium
strong strong
regionalExpression in the turbinate bone.
meckel's cartilage
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 14 15 16 17 18 moderate expression: see section 10 11 13 weak expression: see section 12 19
axial skeleton
strong strong
regionalstrong expression: see section 12 13 14 moderate expression: see section 08 10 11 15 16 17
basioccipital bone
strong strong
regionalstrong expression: see section 01 02 03 04 05 14 15 16 17 18 21 22 moderate expression: see section 06 07 08 09 10 11 12 13 weak expression: see section 19
basisphenoid bone
strong strong
regionalstrong expression: see section 14 15 16 20 moderate expression: see section 11 12 13
temporal bone petrous part
strong strong
regionalstrong expression: see section 01 02 03 04 17 18 20 21 22 weak expression: see section 19
orbito-sphenoid
strong strong
regionalstrong expression: see section 01 02 03 04 05 17 18 20 21 22 moderate expression: see section 06 07 08 09 weak expression: see section 19
clavicle
strong strong
regionalstrong expression: see section 10 17
scapula
strong strong
regionalstrong expression: see section 02 04 05 06 21 22
pelvic girdle skeleton
strong strong
regionalstrong expression: see section 09 15
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T31524
Entity Detected:Mettl22, methyltransferase like 22 ( MGI:2384301)
Sequence:sense strand is shown

>T31524
AGGCTGGGGATGACAACACCATCCAGGAAGGGTTGAGTGTTCCCCTGGACGAGGATGGGGACCTGGATGT
GGTACGAAGGCCACGGGCTGCTTCTGATCCCAACCCGGCAGAGCCCGCAAGAGACAAGGTACACCCCACG
ATTCTAGCACAGGAGGAAGATGACCTCGTGGGAGACCAGGAGTACGAGAGCTGCCCCCACAGCATCATCA
AAATAGAGCACACCATGGCCACGCCCCTGGAGGATGTAGGCAAGCAGGTGTGGCGGGGTGCCCTACTCCT
GGCAGACTATATCCTGTTCCGAAGAGACCTCTTCCAGGGATGCACCGTGCTGGAGCTTGGGGCAGGCACA
GGGCTTGCCAGCATCGTGGCAGCCACGATGGCACACACCGTTTATTGTACAGATGTCGGCACAGACCTCC
TGGCCATGTGCCAACGAAACGTTGCCCTCAACAGCCACCTGACTGCCACTGGAGGTGGCGTGGTTAAGGT
CAAGGAGCTGGACTGGCTGAAGGACAACCTCTGCACAGATCCCAAAGCCCCCTTCAGCTGGTCAGAAGAA
GAAATCGCTGACCTGTATGACCACACCACTGTGCTGCTTGCAGCCGAAGTGTTCTACGATGATGACTTAA
CCAACGCTCTGTTTAACACACTTTCCCGACTGGTCCACAGACTGAAAAATGCCTGCACCGCCATCTTCTC
AGTGGAAAAAAGGTTCAACTTCACACTGAGACACTTGGACGTCACGTGTGAAGCCTACGATCACTTCCGT
GCCTCCCTGGACTCATTGGAGAAGCTGGCCGATGGCAGGCTGCGCTTCATGGTGGAGCCTGTGGAGGCCT
CCTTCCCGCAGCTGCTCGTCTATGAACGCATCCGGCAGCTGGAGCTCTGGAAGATAGTTGTGGAACCAGC
AGCGTGAG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:5359405), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 32074. Forward Primer - name:032074_F_IRAV67-70_C01_BC024814, sequence:AGGCTGGGGATGACAACA; Reverse Primer - name:032074_R_SP6_IRAV67-70_C01_BC024814, sequence:ACTCACGCTGCTGGTTCC. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:18397 same embryo
 EMAGE:18399 same embryo
 EMAGE:18398 same embryo
 EMAGE:18396 same embryo
 EurExpress:euxassay_014351 same experiment
 MGI:4823417 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS