Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:18476

Hs6st2 heparan sulfate 6-O-sulfotransferase 2 ( MGI:1354959)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:18476 EMAGE:18476 EMAGE:18476 EMAGE:18476 EMAGE:18476
"Pseudo-wholemount" of euxassay_014425. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_014425_01 euxassay_014425_02 euxassay_014425_03 euxassay_014425_04
EMAGE:18476 EMAGE:18476 EMAGE:18476 EMAGE:18476 EMAGE:18476
euxassay_014425_05 euxassay_014425_06 euxassay_014425_07 euxassay_014425_08 euxassay_014425_09
EMAGE:18476 EMAGE:18476 EMAGE:18476 EMAGE:18476 EMAGE:18476
euxassay_014425_10 euxassay_014425_11 euxassay_014425_12 euxassay_014425_13 euxassay_014425_14
EMAGE:18476 EMAGE:18476 EMAGE:18476 EMAGE:18476 EMAGE:18476
euxassay_014425_15 euxassay_014425_16 euxassay_014425_17 euxassay_014425_18 euxassay_014425_19
EMAGE:18476 EMAGE:18476 EMAGE:18476 EMAGE:18476 EMAGE:18476
euxassay_014425_20 euxassay_014425_21 euxassay_014425_22 euxassay_014425_23 euxassay_014425_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:18476Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
18476_wholemount_strong.wlz
18476_wholemount_moderate.wlz
18476_wholemount_weak.wlz
18476_wholemount_possible.wlz
18476_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:18476_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
hindlimb digit 1 metatarsal
weak weak
regionalweak expression: see section 02 03 21 22 23
hindlimb digit 1 phalanx
weak weak
regionalweak expression: see section 02
hindlimb digit 2 metatarsal
weak weak
regionalweak expression: see section 02 03 21 23
hindlimb digit 2 phalanx
weak weak
regionalweak expression: see section 02 22
hindlimb digit 3 metatarsal
weak weak
regionalweak expression: see section 02 03 21 23
hindlimb digit 3 phalanx
weak weak
regionalweak expression: see section 02 22
hindlimb digit 4 metatarsal
weak weak
regionalweak expression: see section 03 21 23
hindlimb digit 4 phalanx
weak weak
regionalweak expression: see section 22
hindlimb digit 5 metatarsal
weak weak
regionalweak expression: see section 21
hindlimb digit 5 phalanx
weak weak
regionalweak expression: see section 22
thalamus mantle layer
strong strong
regionalstrong expression: see section 07 08 09 13 14 15
cerebral cortex mantle layer
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 18 19 20 21 22 weak expression: see section 17
telencephalon mantle layer
strong strong
regionalstrong expression: see section 03 04 05 17 18 19 moderate expression: see section 01 02 06 09 10 11 13 14 20 21
medulla oblongata basal plate mantle layer
strong strong
regionalstrong expression: see section 09 10 11 13 14 moderate expression: see section 08 12 15 weak expression: see section 07
rest of cerebellum mantle layer
strong strong
regionalstrong expression: see section 03 04
pons mantle layer
strong strong
regionalstrong expression: see section 05 09 10 11 13 14 15 16 17 18 moderate expression: see section 07 08 weak expression: see section 06
midbrain mantle layer
strong strong
regionalstrong expression: see section 10 11 moderate expression: see section 09 12 13 15
ventral grey horn
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 15
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T31908
Entity Detected:Hs6st2, heparan sulfate 6-O-sulfotransferase 2 ( MGI:1354959)
Sequence:sense strand is shown

>T31908
CATCCCTGCACGTCTGTGATGGAAGGCCCCCAACCTCTGAAGAGCTGCCCAGCTGCTACACCGGTGATGA
CTGGTCTGGATGCCCTCTCAAAGAGTTCATGGACTGTCCCTATAATCTGGCCAACAACCGCCAAGTTCGC
ATGCTATCTGACCTGACTCTAGTGGGATGCTACAACCTCTCTGTCATGCCTGAAAAGCAAAGAAACAAAG
TCCTTCTGGAAAGTGCCAAATCCAATCTGAAGCACATGGCGTTCTTTGGCCTCACTGAGTTTCAGCGCAA
GACCCAGTACCTGTTTGAGAAGACCTTCAACATGAACTTTATCTCGCCGTTTACCCAGTATAATACCACT
AGGGCCTCTAGTGTTGAGATCAATGAGGAAATCCAAAAGCGTATTGAGGGACTGAATTTTCTGGATATGG
AGTTGTACAGCTATGCTAAAGACCTCTTTCTGCAAAGGTATCAGTTCATGAGGCAGAAAGAACATCAGGA
TGCCAGGCGGAAGCGTCAGGAGCAACGCAAATTTCTGAAGGGAAGGTTCCTTCAGACCCATTTCCAGAGT
CAGAGTCAGGGTCAGAGCCAGAGCCAGAGTCCAGGTCAGAATCTGAGTCAGAATCCAAATCCTAACCCAA
ATCAGAACCTGACTCAGAACCTGAGTCACAATCTGACTCCGAGTTCAAATCCCAATTCGACCCAGAGGGA
GAACCGGGGAAGTCAGAAGCAGGGCTCAGGCCAGGGACAAGGTGATAGCGGCACCAGCAATGGCACCAAT
GACTACATAGGGAGCGTAGAGACATGGCG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:6531439), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 61287. Forward Primer - name:061287_F_IRAW4_h09_Hs6st2, sequence:CATCCCTGCACGTCTGTG; Reverse Primer - name:061287_R_SP6_IRAW4_h09_Hs6st2, sequence:GCGCCATGTCTCTACGCT. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:18474 same embryo
 EMAGE:18473 same embryo
 EMAGE:18477 same embryo
 EMAGE:18475 same embryo
 EurExpress:euxassay_014425 same experiment
 MGI:4825457 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS