Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:18581

Emp3 epithelial membrane protein 3 ( MGI:1098729)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:18581 EMAGE:18581 EMAGE:18581 EMAGE:18581 EMAGE:18581
"Pseudo-wholemount" of euxassay_008825. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_008825_01 euxassay_008825_02 euxassay_008825_03 euxassay_008825_04
EMAGE:18581 EMAGE:18581 EMAGE:18581 EMAGE:18581 EMAGE:18581
euxassay_008825_05 euxassay_008825_06 euxassay_008825_07 euxassay_008825_08 euxassay_008825_09
EMAGE:18581 EMAGE:18581 EMAGE:18581 EMAGE:18581 EMAGE:18581
euxassay_008825_10 euxassay_008825_11 euxassay_008825_12 euxassay_008825_13 euxassay_008825_14
EMAGE:18581 EMAGE:18581 EMAGE:18581 EMAGE:18581 EMAGE:18581
euxassay_008825_15 euxassay_008825_16 euxassay_008825_17 euxassay_008825_18 euxassay_008825_19
EMAGE:18581
euxassay_008825_20

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:18581Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
18581_wholemount_strong.wlz
18581_wholemount_moderate.wlz
18581_wholemount_weak.wlz
18581_wholemount_possible.wlz
18581_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:18581_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
rib
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 10 11 12 13 14 15 16 17 18 19
radius
strong strong
regionalstrong expression: see section 20
ulna
strong strong
regionalstrong expression: see section 20
humerus
strong strong
regionalstrong expression: see section 01 02 16 17 18 19 20
forelimb digit 1 phalanx
strong strong
regionalstrong expression: see section 01 02 19
forelimb digit 2 phalanx
strong strong
regionalstrong expression: see section 01 02 19
hindlimb digit 2 phalanx
strong strong
regionalstrong expression: see section 20
hindlimb digit 3 phalanx
strong strong
regionalstrong expression: see section 02 20
hindlimb digit 4 metatarsal
strong strong
regionalstrong expression: see section 01 20
hindlimb digit 4 phalanx
strong strong
regionalstrong expression: see section 01 02 03
hindlimb digit 5 phalanx
strong strong
regionalstrong expression: see section 02 03 20
fibula
strong strong
regionalstrong expression: see section 19 20
tibia
strong strong
regionalstrong expression: see section 19 20
femur
strong strong
regionalstrong expression: see section 01 02 03 04 14 15 16 17 18 19
diencephalon meninges
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17
telencephalon meninges
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
hindbrain meninges
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18
midbrain meninges
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17
spinal cord meninges
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 11
otic capsule
strong strong
regionalstrong expression: see section 04 05 06 07 12 13
viscerocranium
strong strong
regionalExpression in the turbinate bone.
hyoid
strong strong
regionalstrong expression: see section 06 07 08 09 11 12
mandible
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
meckel's cartilage
strong strong
regionalstrong expression: see section 01 06 07 08 09 11 12 13 14
maxilla
strong strong
regionalstrong expression: see section 01 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
axial skeleton
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11
basioccipital bone
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
basisphenoid bone
strong strong
regionalstrong expression: see section 08 09 10 11 12 13 14 15
temporal bone petrous part
strong strong
regionalstrong expression: see section 01 02 03 15 16 17 18 19
vault of skull
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
orbito-sphenoid
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 15 16 17 18 19 20
clavicle
strong strong
regionalstrong expression: see section 05 06 12 13 14 15
scapula
strong strong
regionalstrong expression: see section 16 17 18
pelvic girdle skeleton
strong strong
regionalstrong expression: see section 05 06 12 13
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T2785
Entity Detected:Emp3, epithelial membrane protein 3 ( MGI:1098729)
Sequence:sense strand is shown

>T2785
GGCCTCGAGGCCAGATTCGGCACGAGGCAGCAACTCTCGGCTTGCCTCTCCTGCCCTGAGCCAGACATCT
GGCAGCCATGTCACTCCTCCTGTTGGTGGTCTCTGCCCTCCACATCCTCATTCTTGTCTTGCTTTTTGTG
GCCACTTTGGACAAGTCCTGGTGGACTCTCCCAGACAAAGAGTCCCTGAACCTGTGGTATGACTGCACGT
GGAACACCACCACTCAAACATGGGCCTGCAGTAACGTCAGTGAGAATGGCTGGCTGAAGGCAGTGCAGGC
CCTCATGGTGCTGTCTCTCATCCTCTGCTGCCTGTCCTTCATCCTCTTCATGTTCCAACTCTACACCATG
CGGCGCGGAGGGCTCTTCTACGCTACCGGCCTCTGCCAGCTTTGCACCAGTGCAGCTGTGTTCTCCGGGG
CACTCATCTATGCCATCCACACCGAGGAGATCCTGGCCAAGCACCCGAGTGGGGGCAGCTTCGGTTACTG
CTTCGCCCTGGCCTGGGTGGCTTTTCCACTCGCTCTGGTCAGCGGCACTGTCTACATCCACCTGCGGAAA
CGTGAAT
Notes:The probe template was PCR amplified from IMAGE:1515366 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1515366 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:18582 same embryo
 EurExpress:euxassay_008825 same experiment
 MGI:4824546 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS