Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:18672

Barx1 BarH-like homeobox 1 ( MGI:103124)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:18672 EMAGE:18672 EMAGE:18672 EMAGE:18672 EMAGE:18672
"Pseudo-wholemount" of euxassay_016569. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_016569_01 euxassay_016569_02 euxassay_016569_03 euxassay_016569_04
EMAGE:18672 EMAGE:18672 EMAGE:18672 EMAGE:18672 EMAGE:18672
euxassay_016569_05 euxassay_016569_06 euxassay_016569_07 euxassay_016569_08 euxassay_016569_09
EMAGE:18672 EMAGE:18672 EMAGE:18672 EMAGE:18672 EMAGE:18672
euxassay_016569_10 euxassay_016569_11 euxassay_016569_12 euxassay_016569_13 euxassay_016569_14
EMAGE:18672 EMAGE:18672 EMAGE:18672 EMAGE:18672 EMAGE:18672
euxassay_016569_15 euxassay_016569_16 euxassay_016569_17 euxassay_016569_18 euxassay_016569_19
EMAGE:18672 EMAGE:18672 EMAGE:18672 EMAGE:18672 EMAGE:18672
euxassay_016569_20 euxassay_016569_21 euxassay_016569_22 euxassay_016569_23 euxassay_016569_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:18672Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
18672_wholemount_strong.wlz
18672_wholemount_moderate.wlz
18672_wholemount_weak.wlz
18672_wholemount_possible.wlz
18672_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:18672_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
cranial muscle
moderate moderate
regionalmoderate expression: see section 01 02 03 04 07 08 15 17 18 19 23 weak expression: see section 06 16 20 21 22
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T45044
Entity Detected:Barx1, BarH-like homeobox 1 ( MGI:103124)
Sequence:sense strand is shown

>T45044
AGACAATTAAGGGCCAGACAAGGAAGGACACAGGCCCGGAAGCCAATCCCAGGTGTCAGCGAGCTTCTGT
CCCCAGTCTGGGAGACTTGTGTCCAGCGTGGCCGAAGCTTCTGGTCTTTCTCGGACCTCCGCAGTGTGCG
GCGCTCCACGCTCATTCACGCCCCGCTCCTTGCCCACACTTTTATCCCCGGCCTCCAGCCGGCCTTCTGG
GCCCGGACACCGGCAGGCACACACTTACTTCCGCGCCTTGGGGACCCCGCCACCGGGTGCAGGTCCCTAT
GGCCCTGCCCTGCAGAGCAGAGTCGTCTCTAGCAGATCAGCTGATACCTGGCCTCCCCATGTCGCTGAGG
CTTCTACCCCTCTCTTACAAAGACGG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from genomic DNA prepared from tail-tips of two wild-type C57BL/6J mice), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 166588. Forward Primer - name:166588_F_Barx1, sequence:AGACAATTAAGGGCCAGACAAG; Reverse Primer - name:166588_R_SP6_Barx1, sequence:CCGTCTTTGTAAGAGAGGGGT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:18670 same embryo
 EMAGE:18673 same embryo
 EMAGE:18675 same embryo
 EMAGE:18671 same embryo
 EMAGE:18674 same embryo
 EurExpress:euxassay_016569 same experiment
 MGI:4823393 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS