Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:18805

Tspan7 tetraspanin 7 ( MGI:1298407)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:18805 EMAGE:18805 EMAGE:18805 EMAGE:18805 EMAGE:18805
"Pseudo-wholemount" of euxassay_014270. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_014270_01 euxassay_014270_02 euxassay_014270_03 euxassay_014270_04
EMAGE:18805 EMAGE:18805 EMAGE:18805 EMAGE:18805 EMAGE:18805
euxassay_014270_05 euxassay_014270_06 euxassay_014270_07 euxassay_014270_08 euxassay_014270_09
EMAGE:18805 EMAGE:18805 EMAGE:18805 EMAGE:18805 EMAGE:18805
euxassay_014270_10 euxassay_014270_11 euxassay_014270_12 euxassay_014270_13 euxassay_014270_14
EMAGE:18805 EMAGE:18805 EMAGE:18805 EMAGE:18805 EMAGE:18805
euxassay_014270_15 euxassay_014270_16 euxassay_014270_17 euxassay_014270_18 euxassay_014270_19
EMAGE:18805 EMAGE:18805 EMAGE:18805 EMAGE:18805
euxassay_014270_20 euxassay_014270_21 euxassay_014270_22 euxassay_014270_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:18805Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
18805_wholemount_strong.wlz
18805_wholemount_moderate.wlz
18805_wholemount_weak.wlz
18805_wholemount_possible.wlz
18805_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:18805_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
pancreas
moderate moderate
regionalmoderate expression: see section 08 09
vibrissa
weak weak
regionalweak expression: see section 04 05 06 19 20
diencephalon lateral wall mantle layer
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 16 17 18 weak expression: see section 14 15
telencephalon mantle layer
moderate moderate
regionalmoderate expression: see section 01 02 07 08 09 10 11 12 13 16 17 18 21 22 23 weak expression: see section 03 04 05 06 14 15 19 20
telencephalon ventricular layer
moderate moderate
regionalmoderate expression: see section 21 22 23 weak expression: see section 02 03 04 05 06 19 20
medulla oblongata alar plate mantle layer
moderate moderate
regionalmoderate expression: see section 09 16 17
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13 16 17
medulla oblongata basal plate ventricular layer
strong strong
regionalstrong expression: see section 11 12
rest of cerebellum mantle layer
moderate moderate
regionalmoderate expression: see section 07 16
rest of cerebellum ventricular layer
strong strong
regionalstrong expression: see section 05 moderate expression: see section 03 04 06 09 10 11 12 17 18 19 weak expression: see section 13 20
pons mantle layer
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 12 13 16 17 18 19 weak expression: see section 14 15
pons ventricular layer
strong strong
regionalstrong expression: see section 11 moderate expression: see section 09 10 12 13 17 18 weak expression: see section 08
midbrain mantle layer
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 16 17 18 19 weak expression: see section 14 15
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 03 04 05 19 20
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 05 06 weak expression: see section 17
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 19 20 21 22 weak expression: see section 08 16 17 18
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 07 weak expression: see section 16
trigeminal v nerve
weak weak
regionalweak expression: see section 08 16
spinal cord mantle layer
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13
cervico-thoracic ganglion
moderate moderate
regionalmoderate expression: see section 07 weak expression: see section 08
cervical ganglion
moderate moderate
regionalmoderate expression: see section 07 weak expression: see section 08
thoracic ganglion
weak weak
regionalweak expression: see section 10 11 12
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 06 07 weak expression: see section 08 09 13 16
neural retina
weak weak
regionalweak expression: see section 01 02 22 23
midgut
weak weak
regionalweak expression: see section 08 09 10 11 12 13 14
bladder
weak weak
regionalweak expression: see section 11 12 13
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T2476
Entity Detected:Tspan7, tetraspanin 7 ( MGI:1298407)
Sequence:sense strand is shown

>T2476
CTCCNTANNGTCCATCTTGTGAAGCCCTGTTGTGCCCCACAGTGTAGCCAGGCCCCCTGCAGCTAGTCAT
AGTGAAGCCCACCCTAAGGCCCTGTGAGCGCCAGCTCCCTCACATGTACTTGGTCCAACTGTAGGTGACT
GGTTATCACATCTTCACTGGCCCCTGTGGCCCTGCATGTAGTAGGGGAGGCTTCAGTCAGCCCCTCACTG
TGGTCCAAGAATGCCACACACCTTTCCGTAGATATGCCGATGGTAATTATCTTTTCTTTTGGCTTAATCC
GATTTGGTTTGGTTTTTCCCTTTCCCTGGATTCTTTCCTACCTTCTTCAGGCTGTCAAGCACGGGAGAGG
AGACACAGTGGGAGGGATTCATAAGGAGAAAACAGCGTCTGGCAGGCATGGCAGAAAGTGCTGTTAAGCA
TTAGCTGGCTTCCTTGTTCATTGTTCCAAGAGATGGGTGTGGAGAGACGGCTTAGTGTAGGATCCTCTCG
AATGA
Notes:The probe template was PCR amplified from IMAGE:1248433 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1248433 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:18807 same embryo
 EMAGE:18804 same embryo
 EMAGE:18806 same embryo
 EurExpress:euxassay_014270 same experiment
 MGI:4828970 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS