Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:18852

Wdpcp WD repeat containing planar cell polarity effector ( MGI:2144467)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:18852 EMAGE:18852 EMAGE:18852 EMAGE:18852 EMAGE:18852
"Pseudo-wholemount" of euxassay_014120. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_014120_01 euxassay_014120_02 euxassay_014120_03 euxassay_014120_04
EMAGE:18852 EMAGE:18852 EMAGE:18852 EMAGE:18852 EMAGE:18852
euxassay_014120_05 euxassay_014120_06 euxassay_014120_07 euxassay_014120_08 euxassay_014120_09
EMAGE:18852 EMAGE:18852 EMAGE:18852 EMAGE:18852 EMAGE:18852
euxassay_014120_10 euxassay_014120_11 euxassay_014120_12 euxassay_014120_13 euxassay_014120_14
EMAGE:18852 EMAGE:18852 EMAGE:18852 EMAGE:18852 EMAGE:18852
euxassay_014120_15 euxassay_014120_16 euxassay_014120_17 euxassay_014120_18 euxassay_014120_19
EMAGE:18852 EMAGE:18852 EMAGE:18852
euxassay_014120_20 euxassay_014120_21 euxassay_014120_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:18852Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
18852_wholemount_strong.wlz
18852_wholemount_moderate.wlz
18852_wholemount_weak.wlz
18852_wholemount_possible.wlz
18852_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:18852_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
medulla oblongata part of 4th ventricle choroid plexus
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
diencephalon lateral wall mantle layer
strong strong
regionalstrong expression: see section 10
diencephalon roof plate
strong strong
regionalstrong expression: see section 10 11 12
choroid invagination
strong strong
regionalstrong expression: see section 05 06 07 08 09 13 14 15 16 17
medulla oblongata floor plate
strong strong
regionalstrong expression: see section 10
metencephalon floor plate
strong strong
regionalstrong expression: see section 10
metencephalon part of 4th ventricle choroid plexus
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
midbrain floor plate
strong strong
regionalstrong expression: see section 10
tegmentum
strong strong
regionalstrong expression: see section 08 09
anterior naris epithelium
strong strong
regionalstrong expression: see section 09 10 12 13
external naris epithelium
strong strong
regionalstrong expression: see section 09 13
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 06 07 08 09 10 12 13 14 15 16
naso-lacrimal duct
strong strong
regionalstrong expression: see section 02 03 04 05 06 14 15 16 17 18 19
pharynx epithelium
strong strong
regionalstrong expression: see section 09 10 11 12 13
oral epithelium
strong strong
regionalstrong expression: see section 09 10 11 12 13
larynx
strong strong
regionalstrong expression: see section 11 12
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T2443
Entity Detected:Wdpcp, WD repeat containing planar cell polarity effector ( MGI:2144467)
Sequence:sense strand is shown

>T2443
TCNAGGCCAGATTCGGCACGAGGGAAAACTTCGAGATTCACTGAAGGAGTTGGAGGAACTGATGCAAAGC
AGTCCGTGTGTGCTGAGCAAATGGAAGAGCAAATACATCTGCCAGCTCCTGTTTGGTTCAGGTGTGCTGG
TGTCCCTAAGTCTTTCTGGGCCTCAGCTGGAGAAAGTGGTGATTGACAGAAGCCTGGTGGGGAAGCTCAT
CTCAGACACCATCAGTGATGCTCTCCTTACAGACAGTTTCATCATCTTATCATTTCTGGCACAAAACAAA
CTATGTTTTATTCAGTTTACAAAGAAAATGGATTCTCTTGATGGAAACAAGAGGCTGGAGAAACTCTCAG
CCTTGGACCTTAAGATTTCCTATTATGACATACCTGGCCCAGCCAACAGGACAATAGATCGTCACTTAGC
TGTCAACTCCACTCAGGATCTAGTTGTTTGTTGGTGGCCGCTGGTCAGTGATGATGTTTGGCCTTGGACT
CCAGTTTCTTCTGAGAAGGACAGAGCCAATATGCTGTTGCTGGGCTTTACTCAAGGAGGATTGGAGGTTC
TAAGTTTTGTTCGCACA
Notes:The probe template was PCR amplified from IMAGE:1246493 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1246493 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:18853 same embryo
 EMAGE:18851 same embryo
 EurExpress:euxassay_014120 same experiment
 MGI:4823359 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS