Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:18891

Gm7325 predicted gene 7325 ( MGI:3649059)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:18891 EMAGE:18891 EMAGE:18891 EMAGE:18891 EMAGE:18891
"Pseudo-wholemount" of euxassay_014154. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_014154_01 euxassay_014154_02 euxassay_014154_03 euxassay_014154_04
EMAGE:18891 EMAGE:18891 EMAGE:18891 EMAGE:18891 EMAGE:18891
euxassay_014154_05 euxassay_014154_06 euxassay_014154_07 euxassay_014154_08 euxassay_014154_09
EMAGE:18891 EMAGE:18891 EMAGE:18891 EMAGE:18891 EMAGE:18891
euxassay_014154_10 euxassay_014154_11 euxassay_014154_12 euxassay_014154_13 euxassay_014154_14
EMAGE:18891 EMAGE:18891 EMAGE:18891 EMAGE:18891 EMAGE:18891
euxassay_014154_15 euxassay_014154_16 euxassay_014154_17 euxassay_014154_18 euxassay_014154_19
EMAGE:18891 EMAGE:18891 EMAGE:18891 EMAGE:18891
euxassay_014154_20 euxassay_014154_21 euxassay_014154_22 euxassay_014154_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:18891Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
18891_wholemount_strong.wlz
18891_wholemount_moderate.wlz
18891_wholemount_weak.wlz
18891_wholemount_possible.wlz
18891_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:18891_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
upper arm muscle
moderate moderate
regionalmoderate expression: see section 01 02 03 20 21 22 23
upper leg muscle
moderate moderate
regionalmoderate expression: see section 18 19 20 21 22
diaphragm
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
forearm rest of mesenchyme
moderate moderate
regionalmoderate expression: see section 22 23
hand
moderate moderate
regionalmoderate expression: see section 21 22
foot
moderate moderate
regionalmoderate expression: see section 20 21
lower leg rest of mesenchyme
moderate moderate
regionalmoderate expression: see section 20 21 22 23
vertebral axis musculature
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
thymus primordium
weak weak
regionalweak expression: see section 09 10 11 12 13
eye skeletal muscle
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 18 19 20 21
tongue muscle
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15
tail paraxial mesenchyme
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15 16 17
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T39953
Entity Detected:Gm7325, predicted gene 7325 ( MGI:3649059)
Sequence:sense strand is shown

>T39953
CCAGAAGAAAGCTGCACTGTAAAACTAATCCAGTTGAAAACTGGGGAGTACAGAGGTGCAGGTCCTGCCA
TGCCCGTTCCATTGCTCCCGATGGTGCTTCGATCGCTGCTGTCCCGCCTGCTGCTGCCTGTTGCCCGCCT
GGCCCGGCAGCACCTCCTGCCCTTGCTGCGCCGGCTGGCCCGCCGACTGAGCTCCCAAGACATGAGAGAG
GCTCTGCTGAGCTGTCTGCTCTTTGTCCTCAGCCAGCAACAGCCACCGGATTCTGGAGAGGCCTCCAGAG
TGGACCACTCCCAGAGGAAGGAGAGATTGGGCCCCCAGAAGTGAGGCCACGGGTCCTGGAAACAGCAACG
CCCATCAAAGTACTTTTGGAGCCGGTTAGTCCAGGCGTCGGTCCGCACGCACGGGCATGGACGGCAGACT
GCCCAGTGGGCGAAGACAGTCCGGGCTGAGTGCAAGAGGGCTCTGACCTGAACAGTTCCCACTCCCCTAG
CTCCTAGCAGGCTACA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 235397. Forward Primer - name:164552_F_cDNA_LOC433110, sequence:CCAGAAGAAAGCTGCACTGTAA; Reverse Primer - name:164552_N_SP6_cDNA_LOC433110, sequence:TGTAGCCTGCTAGGAGCTAGGG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:18890 same embryo
 EMAGE:18894 same embryo
 EMAGE:18895 same embryo
 EMAGE:18892 same embryo
 EMAGE:18893 same embryo
 EurExpress:euxassay_014154 same experiment
 MGI:4825117 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS