Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:19004

Irs2 insulin receptor substrate 2 ( MGI:109334)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:19004 EMAGE:19004 EMAGE:19004 EMAGE:19004 EMAGE:19004
"Pseudo-wholemount" of euxassay_014216. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_014216_01 euxassay_014216_02 euxassay_014216_03 euxassay_014216_04
EMAGE:19004 EMAGE:19004 EMAGE:19004 EMAGE:19004 EMAGE:19004
euxassay_014216_05 euxassay_014216_06 euxassay_014216_07 euxassay_014216_08 euxassay_014216_09
EMAGE:19004 EMAGE:19004 EMAGE:19004 EMAGE:19004 EMAGE:19004
euxassay_014216_10 euxassay_014216_11 euxassay_014216_12 euxassay_014216_13 euxassay_014216_14
EMAGE:19004 EMAGE:19004 EMAGE:19004 EMAGE:19004 EMAGE:19004
euxassay_014216_15 euxassay_014216_16 euxassay_014216_17 euxassay_014216_18 euxassay_014216_19
EMAGE:19004 EMAGE:19004 EMAGE:19004
euxassay_014216_20 euxassay_014216_21 euxassay_014216_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:19004Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
19004_wholemount_strong.wlz
19004_wholemount_moderate.wlz
19004_wholemount_weak.wlz
19004_wholemount_possible.wlz
19004_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:19004_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
hindlimb digit 1 skin
moderate moderate
regionalmoderate expression: see section 06 07 21 22
hindlimb digit 2 skin
moderate moderate
regionalmoderate expression: see section 07 08 21 22
hindlimb digit 3 skin
moderate moderate
regionalmoderate expression: see section 08 21 22
hindlimb digit 4 skin
moderate moderate
regionalmoderate expression: see section 22
thymus primordium
moderate moderate
regionalmoderate expression: see section 09 weak expression: see section 10 11 12
diencephalon lateral wall ventricular layer
weak weak
regionalweak expression: see section 10 11 12 13
telencephalon ventricular layer
weak weak
regionalweak expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19
midbrain ventricular layer
weak weak
regionalweak expression: see section 05 06 07 08 09 10 11 12 13
dorsal root ganglion
moderate moderate
single cellmoderate expression: see section 08 09 12 13 15
lower lip
moderate moderate
regionalmoderate expression: see section 09 10 11 12 14 15 16
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 14 15 weak expression: see section 11 12
lower jaw molar
weak weak
regionalweak expression: see section 07
upper lip
moderate moderate
regionalmoderate expression: see section 09
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 14 15 weak expression: see section 11 12
upper jaw molar
moderate moderate
regionalmoderate expression: see section 06 18
renal cortex
moderate moderate
regionalmoderate expression: see section 16 17 18 weak expression: see section 06 07 08 09 14 15
tail skeleton
moderate moderate
regionalmoderate expression: see section 13 14 15 16
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T38754
Entity Detected:Irs2, insulin receptor substrate 2 ( MGI:109334)
Sequence:sense strand is shown

>T38754
TTCATGTCCCTTGACGAGTATGGCTCCAGCCCTGGCGACCTGAGAGCCTTCAGTAGCCACAGGAGCAACA
CACCCGAGTCAATAGCGGAGACCCCGCCAGCCAGAGATGGCAGTGGGGGCGAACTCTATGGGTACATGAG
CATGGATAGACCCCTGAGCCACTGTGGCCGCCCTTACCGTAGGGTCTCAGGGGATGGGGCCCAGGACCTG
GATAGAGGACTGAGGAAGAGGACTTATTCCCTAACCACGCCTGCCAGGCAGCGGCAGGTACCTCAGCCTT
CCTCTGCCTCTCTAGATGAATACACTCTCATGAGGGCCACCTTCTCTGGTAGTTCAGGTCGCCTCTGCCC
ATCCTTCCCTGCGTCCTCTCCCAAAGTGGCCTACAACCCTTACCCAGAGGACTATGGAGACATTGAGATT
GGTTCTCACAAGAGTTCCAGCAGTAACCTGGGGGCAGATGATGGCTACATGCCCATGACCCCTGGGGCAG
CCCTTAGGAGTGGTGGTCCCAATAGCTGCAAGAGCGATGACTACATGCCCATGAGCCCCACAAGCGTGTC
TGCTCCCAAGCAGATCCTGCAGCCACGCTTGGCAGCGGCCTTGCCCCCTTCCGGAGCAGCCGTGCCAGCA
CCCCCTTCAGGGGTGGGCAGGACCTTCCCAGTAAACGGAGGTGGCTACAAAGCCAGCTCCCCAGCGGAGA
GCTCCCCAGAAGACAGTGGGTACATGCGAATGTGGTGTG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 162717. Forward Primer - name:162717_F_cDNA_mCG17323.2, sequence:TTCATGTCCCTTGACGAGTATG; Reverse Primer - name:162717_N_SP6_cDNA_mCG17323.2, sequence:CACACCACATTCGCATGTACC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:19005 same embryo
 EMAGE:19003 same embryo
 EMAGE:19001 same embryo
 EMAGE:19002 same embryo
 EMAGE:19000 same embryo
 EurExpress:euxassay_014216 same experiment
 MGI:4825620 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS