Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:19054

Kif1a kinesin family member 1A ( MGI:108391)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:19054 EMAGE:19054 EMAGE:19054 EMAGE:19054 EMAGE:19054
"Pseudo-wholemount" of euxassay_015906. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_015906_01 euxassay_015906_02 euxassay_015906_03 euxassay_015906_04
EMAGE:19054 EMAGE:19054 EMAGE:19054 EMAGE:19054 EMAGE:19054
euxassay_015906_05 euxassay_015906_06 euxassay_015906_07 euxassay_015906_08 euxassay_015906_09
EMAGE:19054 EMAGE:19054 EMAGE:19054 EMAGE:19054 EMAGE:19054
euxassay_015906_10 euxassay_015906_11 euxassay_015906_12 euxassay_015906_13 euxassay_015906_14
EMAGE:19054 EMAGE:19054 EMAGE:19054 EMAGE:19054 EMAGE:19054
euxassay_015906_15 euxassay_015906_16 euxassay_015906_17 euxassay_015906_18 euxassay_015906_19
EMAGE:19054 EMAGE:19054 EMAGE:19054
euxassay_015906_20 euxassay_015906_21 euxassay_015906_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:19054Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
19054_wholemount_strong.wlz
19054_wholemount_moderate.wlz
19054_wholemount_weak.wlz
19054_wholemount_possible.wlz
19054_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:19054_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
diencephalon lateral wall mantle layer
strong strong
homogeneousstrong expression: see section 05 06 07 08 09 10 11 12 13 14 15
telencephalon mantle layer
strong strong
homogeneousstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
medulla oblongata alar plate
strong strong
homogeneousstrong expression: see section 07 08 09 10 11 14 15 16 17
medulla oblongata basal plate
strong strong
homogeneousstrong expression: see section 07 08 09 10 11 12 13 14 15 16 17
cerebellum
strong strong
homogeneousstrong expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
metencephalon basal plate
strong strong
homogeneousstrong expression: see section 05 07 08 09 10 11 12 13 14 15 16 17
midbrain mantle layer
strong strong
homogeneousstrong expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18
facial vii ganglion
strong strong
regionalstrong expression: see section 02 03 04 05 17 18 19
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 06 07 17
trigeminal v ganglion
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 15 16 17 18 19 20
vagus x ganglion
strong strong
regionalstrong expression: see section 16 moderate expression: see section 08
vestibulocochlear viii ganglion
weak weak
regionalweak expression: see section 06 07 16 17
trigeminal v nerve
strong strong
regionalstrong expression: see section 07 14
spinal cord mantle layer
strong strong
homogeneousstrong expression: see section 11 12 13 14 15 16
cervico-thoracic ganglion
strong strong
regionalstrong expression: see section 09 moderate expression: see section 10
thoracic ganglion
moderate moderate
regionalmoderate expression: see section 13 14
dorsal root ganglion
strong strong
regionalstrong expression: see section 09 10 11 15 16 17 18 moderate expression: see section 08
neural retina
strong strong
regionalstrong expression: see section 19 20 21 22 weak expression: see section 01
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 11 12 weak expression: see section 13 14
vomeronasal organ
moderate moderate
regionalmoderate expression: see section 09 11
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T63242
Entity Detected:Kif1a, kinesin family member 1A ( MGI:108391)
Sequence:sense strand is shown

>T63242
CTTCGGAAATGACACTAGGACCTTCTACCAGTTTGAAGCAGCCTGGGACAGTTCCATGCATAACTCTCTC
CTGCTGAATCGTGTCACCCCTTACCGGGAGAAAATCTACATGACGCTCTCTGCCTACATTGAGATGGAGA
ACTGTACCCAGCCAGCTGTCATCACCAAGGACTTCTGCATGGTTTTCTACTCTCGGGACGCCAAGCTACC
CGCCTCACGCTCCATTCGCAACCTGTTTGGCAGTGGCAGCCTGCGGGCCACAGAAGGCAACCGTGTGACT
GGTGTGTATGAGCTCAGCCTTTGCCACGTGGCCGACGCAGGCAGCCCAGGGATGCAGCGTCGGCGCCGGC
GGGTGCTGGACACATCAGTAGCCTATGTCCGGGGTGAGGAGAACCTGGCTGGCTGGAGGCCCCGAAGTGA
CAGCCTGATCCTAGATCACCAGTGGGAACTGGAGAAACTGAGCCTCTTACAGGAGGTGGAAAAGACCAGG
CACTACCTGCTCCTTCGGGAGAAGCTGGAGACGACCCAGCGCCCTGGCCCTGAGGTGCTGTCCCCAGCCT
CCAGTGAGGACTCTGAGTCCCGTAGTTCTTCAGGTGCCTCTTCCCCATTGTCAGCCGAGGGTCAGCCGTC
ACCTCTGGAGGCTCCCAACGAGAGGCAGAGGGAGCTGGCTGTCAAGTGCTTACGACTCCTCATGCA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 98009. Forward Primer - name:098009_F_cDNA_Kif1a, sequence:CTTCGGAAATGACACTAGGACC; Reverse Primer - name:098009_N_SP6_cDNA_Kif1a, sequence:TGCATGAGGAGTCGTAAGCAC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:19056 same embryo
 EMAGE:19051 same embryo
 EMAGE:19053 same embryo
 EMAGE:19052 same embryo
 EMAGE:19055 same embryo
 EurExpress:euxassay_015906 same experiment
 MGI:4825753 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS