Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:19077

Kif5c kinesin family member 5C ( MGI:1098269)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:19077 EMAGE:19077 EMAGE:19077 EMAGE:19077 EMAGE:19077
"Pseudo-wholemount" of euxassay_015929. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_015929_01 euxassay_015929_02 euxassay_015929_03 euxassay_015929_04
EMAGE:19077 EMAGE:19077 EMAGE:19077 EMAGE:19077 EMAGE:19077
euxassay_015929_05 euxassay_015929_06 euxassay_015929_07 euxassay_015929_08 euxassay_015929_09
EMAGE:19077 EMAGE:19077 EMAGE:19077 EMAGE:19077 EMAGE:19077
euxassay_015929_10 euxassay_015929_11 euxassay_015929_12 euxassay_015929_13 euxassay_015929_14
EMAGE:19077 EMAGE:19077 EMAGE:19077 EMAGE:19077 EMAGE:19077
euxassay_015929_15 euxassay_015929_16 euxassay_015929_17 euxassay_015929_18 euxassay_015929_19
EMAGE:19077 EMAGE:19077 EMAGE:19077 EMAGE:19077
euxassay_015929_20 euxassay_015929_21 euxassay_015929_22 euxassay_015929_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:19077Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
19077_wholemount_strong.wlz
19077_wholemount_moderate.wlz
19077_wholemount_weak.wlz
19077_wholemount_possible.wlz
19077_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:19077_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
diencephalon
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13 14 15 16 17
telencephalon
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
hindbrain
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
midbrain
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18
facial vii ganglion
strong strong
regionalstrong expression: see section 04 19 20 21 moderate expression: see section 05
glossopharyngeal ix ganglion
weak weak
regionalweak expression: see section 07 08 17 18
trigeminal v ganglion
strong strong
regionalstrong expression: see section 03 04 06 08 09 16 17 19 20 21 moderate expression: see section 05 07 18 22
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 19 weak expression: see section 06 07 08 17 18
trigeminal v nerve
strong strong
regionalstrong expression: see section 09 16
spinal cord
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14
cervico-thoracic ganglion
weak weak
regionalweak expression: see section 16
cervical ganglion
weak weak
regionalweak expression: see section 09
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 09 10 11 12 14 15 16
neural retina
strong strong
regionalstrong expression: see section 01 02 23 moderate expression: see section 03
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 08 09 12 13 14 16 moderate expression: see section 10 11 15
vomeronasal organ
moderate moderate
regionalmoderate expression: see section 14 weak expression: see section 12
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T63400
Entity Detected:Kif5c, kinesin family member 5C ( MGI:1098269)
Sequence:sense strand is shown

>T63400
CCCCTAGGTTCCCATTTTCTACTTCTGAAGAGTTGTGGGGCACTTTCAAGTTTTAAAAGGCAGCATTCGT
TTGTAGTTCACATTACTTGATCTCTACAAGGGCCTTACAAAATTCACTGTACTTTTATTCACAGAGAAAG
TTGGCTTTGATGTCTTTTAGAGATAATTCTGCTAGTTGCTGATCAGCCAGTCAGTTCATCTAGCGCCAGT
CTTTATAAGACCTCTAATCGAATTTTCTCACACTGTGACTAAAAGCTAGGCACGTCATTGGAACAGATCA
TGTGGTTTATTCAAGCAATCCCTAATCTCACATTGTCTATTAATTCCTTTATCAGAACAGTGTGCTCTCG
GGCCGCTTTTTTAAAAGGCCATGTTTATAAAGTTTTCATTGTTTGACAGGCTGTTACATTCTATATTCTA
GCTGTAAAAATCCCACTTCTGAACAGCCAAGTGGATGGCTCCATTTCGTCACATGTTTCACATTGCTGGA
ATGTATGCCAGTGTATGTTCTCTGAATAATTTACTATCTCATGCCTACTTCTTGAAAGTTTACTCTGAGA
TGCCGTAGGAGTGCAGCCAGATGGTTTAGACAAATAACCTCTGCCTGCCAGCCGTTGGGGTGATGATTAG
AATGT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 96754. Forward Primer - name:096754_F_cDNA_Kif5c, sequence:CCCCTAGGTTCCCATTTTCTAC; Reverse Primer - name:096754_N_SP6_cDNA_Kif5c, sequence:ACATTCTAATCATCACCCCAACG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:MGI:4825769 same experiment
 EurExpress:euxassay_015929 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS