Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:19078

Mir721 microRNA 721 ( MGI:3624349)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:19078 EMAGE:19078 EMAGE:19078 EMAGE:19078 EMAGE:19078
"Pseudo-wholemount" of euxassay_019408. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_019408_01 euxassay_019408_02 euxassay_019408_03 euxassay_019408_04
EMAGE:19078 EMAGE:19078 EMAGE:19078 EMAGE:19078 EMAGE:19078
euxassay_019408_05 euxassay_019408_06 euxassay_019408_07 euxassay_019408_08 euxassay_019408_09
EMAGE:19078 EMAGE:19078 EMAGE:19078 EMAGE:19078 EMAGE:19078
euxassay_019408_10 euxassay_019408_11 euxassay_019408_12 euxassay_019408_13 euxassay_019408_14
EMAGE:19078 EMAGE:19078 EMAGE:19078 EMAGE:19078 EMAGE:19078
euxassay_019408_15 euxassay_019408_16 euxassay_019408_17 euxassay_019408_18 euxassay_019408_19
EMAGE:19078 EMAGE:19078 EMAGE:19078 EMAGE:19078 EMAGE:19078
euxassay_019408_20 euxassay_019408_21 euxassay_019408_22 euxassay_019408_23 euxassay_019408_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:19078Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
19078_wholemount_strong.wlz
19078_wholemount_moderate.wlz
19078_wholemount_weak.wlz
19078_wholemount_possible.wlz
19078_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:19078_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
humerus
moderate moderate
regionalmoderate expression: see section 01 02 weak expression: see section 03 20 22 23 24
fibula
weak weak
regionalweak expression: see section 01 02
tibia
weak weak
regionalweak expression: see section 01
femur
weak weak
regionalweak expression: see section 02 03 05 19 20 21 22 23
lower lip
weak weak
regionalweak expression: see section 13 14
meckel's cartilage
moderate moderate
regionalmoderate expression: see section 05 weak expression: see section 02 03 04 06 08 09 10 11 12 13 14 15 16 17 18 19 20 21
upper lip
weak weak
regionalweak expression: see section 09 10 11 13 14 15
basioccipital bone
weak weak
regionalweak expression: see section 09 10 11 12 13 14
basisphenoid bone
weak weak
regionalweak expression: see section 09 10 11 12 13
exoccipital bone
moderate moderate
regionalmoderate expression: see section 01 02 18 19 21 weak expression: see section 03 04 05
temporal bone
moderate moderate
regionalmoderate expression: see section 01 02 18 19 21 22 23 weak expression: see section 03
orbito-sphenoid
moderate moderate
regionalmoderate expression: see section 01 02 06 18 19 21 22 23 weak expression: see section 04 05 07 17
viscerocranium
moderate moderate
regionalExpression in the turbinate bone.
scapula
weak weak
regionalweak expression: see section 01 02 03 19 20 21
pelvic girdle skeleton
weak weak
regionalweak expression: see section 08 09 16 17
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T70170
Entity Detected:Mir721, microRNA 721 ( MGI:3624349)
Sequence:sense strand is shown

>T70170
CAGTGCAATTAAAAGGGGGAA
Notes:The probe used by the EURExpress consortium to detect the presence of miRNA mmu-miR-721 was custom designed and ordered from Sigma-Exiqon by the EURExpress partner in Geneva and then distributed to the ISH generating units within the consortium.
Chemistry:LNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:19079 same embryo
 EMAGE:19081 same embryo
 EMAGE:19080 same embryo
 EMAGE:19082 same embryo
 EurExpress:euxassay_019408 same experiment
 MGI:4826373 same experiment
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS