Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:19083

Mir770 microRNA 770 ( MGI:3691606)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:19083 EMAGE:19083 EMAGE:19083 EMAGE:19083 EMAGE:19083
"Pseudo-wholemount" of euxassay_019416. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_019416_01 euxassay_019416_02 euxassay_019416_03 euxassay_019416_04
EMAGE:19083 EMAGE:19083 EMAGE:19083 EMAGE:19083 EMAGE:19083
euxassay_019416_05 euxassay_019416_06 euxassay_019416_07 euxassay_019416_08 euxassay_019416_09
EMAGE:19083 EMAGE:19083 EMAGE:19083 EMAGE:19083 EMAGE:19083
euxassay_019416_10 euxassay_019416_11 euxassay_019416_12 euxassay_019416_13 euxassay_019416_14
EMAGE:19083 EMAGE:19083 EMAGE:19083 EMAGE:19083 EMAGE:19083
euxassay_019416_15 euxassay_019416_16 euxassay_019416_17 euxassay_019416_18 euxassay_019416_19
EMAGE:19083 EMAGE:19083 EMAGE:19083 EMAGE:19083 EMAGE:19083
euxassay_019416_20 euxassay_019416_21 euxassay_019416_22 euxassay_019416_23 euxassay_019416_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:19083Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
19083_wholemount_strong.wlz
19083_wholemount_moderate.wlz
19083_wholemount_weak.wlz
19083_wholemount_possible.wlz
19083_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:19083_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
rib
moderate moderate
regionalmoderate expression: see section 04 05 06 09 10 11 12 13 18 19 20 weak expression: see section 07 08 21 22 23 24
humerus
strong strong
regionalstrong expression: see section 01 02 04 05 06 moderate expression: see section 03 07 08 24
hindlimb digit 2 phalanx
moderate moderate
regionalmoderate expression: see section 07 weak expression: see section 23 24
hindlimb digit 3 phalanx
moderate moderate
regionalmoderate expression: see section 07 weak expression: see section 23 24
hindlimb digit 4 phalanx
moderate moderate
regionalmoderate expression: see section 07 weak expression: see section 23 24
hindlimb digit 5 phalanx
weak weak
regionalweak expression: see section 24
foot mesenchyme
moderate moderate
regionalmoderate expression: see section 06
fibula
moderate moderate
regionalmoderate expression: see section 02 03 04 05
tibia
moderate moderate
regionalmoderate expression: see section 03 04
femur
strong strong
regionalstrong expression: see section 08 moderate expression: see section 03 04 05 06 07 09 23 24
otic capsule
moderate moderate
regionalmoderate expression: see section 10 11 18 19 20
nasal septum
weak weak
regionalweak expression: see section 11 12
hyoid
moderate moderate
regionalmoderate expression: see section 11 13 14 15 weak expression: see section 16
meckel's cartilage
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 10 11 16 moderate expression: see section 12 13 14 15 18 19 20 weak expression: see section 17 21 22 23
axial skeleton
strong strong
regionalstrong expression: see section 13 14 15 16 moderate expression: see section 11 12 17 18 19 20 weak expression: see section 21
basioccipital bone
moderate moderate
regionalmoderate expression: see section 11 12 13 14 15 16 17 18 19
basisphenoid bone
moderate moderate
regionalmoderate expression: see section 11 12 13 14 15 16
exoccipital bone
moderate moderate
regionalmoderate expression: see section 03 05 06 07 08 09 10 23 24
temporal bone
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 23 24
orbito-sphenoid
moderate moderate
regionalmoderate expression: see section 02 05 06 08 18 19 20 24
viscerocranium
moderate moderate
regionalExpression in the turbinate bone.
clavicle
moderate moderate
regionalmoderate expression: see section 10 11 19 20
scapula
moderate moderate
regionalmoderate expression: see section 04 05 06 07 24
pelvic girdle skeleton
moderate moderate
regionalmoderate expression: see section 10 11 12 19 20
axial skeleton tail region
strong strong
regionalstrong expression: see section 16
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T70186
Entity Detected:Mir770, microRNA 770 ( MGI:3691606)
Sequence:sense strand is shown

>T70186
AGCACCACGTGTCTGGGCCACG
Notes:The probe used by the EURExpress consortium to detect the presence of miRNA mmu-miR-770-5p was custom designed and ordered from Sigma-Exiqon by the EURExpress partner in Geneva and then distributed to the ISH generating units within the consortium.
Chemistry:LNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:19085 same embryo
 EMAGE:19084 same embryo
 EurExpress:euxassay_019416 same experiment
 MGI:4826378 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS