Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:19087

Mir93 microRNA 93 ( MGI:3619439)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:19087 EMAGE:19087 EMAGE:19087 EMAGE:19087 EMAGE:19087
"Pseudo-wholemount" of euxassay_019428. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_019428_01 euxassay_019428_02 euxassay_019428_03 euxassay_019428_04
EMAGE:19087 EMAGE:19087 EMAGE:19087 EMAGE:19087 EMAGE:19087
euxassay_019428_05 euxassay_019428_06 euxassay_019428_07 euxassay_019428_08 euxassay_019428_09
EMAGE:19087 EMAGE:19087 EMAGE:19087 EMAGE:19087 EMAGE:19087
euxassay_019428_10 euxassay_019428_11 euxassay_019428_12 euxassay_019428_13 euxassay_019428_14
EMAGE:19087 EMAGE:19087 EMAGE:19087 EMAGE:19087 EMAGE:19087
euxassay_019428_15 euxassay_019428_16 euxassay_019428_17 euxassay_019428_18 euxassay_019428_19
EMAGE:19087 EMAGE:19087 EMAGE:19087
euxassay_019428_20 euxassay_019428_21 euxassay_019428_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:19087Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
19087_wholemount_strong.wlz
19087_wholemount_moderate.wlz
19087_wholemount_weak.wlz
19087_wholemount_possible.wlz
19087_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:19087_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
rib
moderate moderate
regionalmoderate expression: see section 05 weak expression: see section 02 03 04 06 14 15 16 17 18 19 20
humerus
weak weak
regionalweak expression: see section 01 02 19 20 21 22
fibula
weak weak
regionalweak expression: see section 01 02
tibia
weak weak
regionalweak expression: see section 01 02
femur
weak weak
regionalweak expression: see section 01 02 03 04 05 06 19 20 21 22
meckel's cartilage
moderate moderate
regionalmoderate expression: see section 17 18 weak expression: see section 01 02 03 04 05 06 07 08 09 10 15 16 19
axial skeleton
moderate moderate
regionalmoderate expression: see section 05 weak expression: see section 04 06 07 08 09 10 11 12 13 14
basioccipital bone
weak weak
regionalweak expression: see section 07 08 09 10 12 13
basisphenoid bone
weak weak
regionalweak expression: see section 09 10 12 13
exoccipital bone
moderate moderate
regionalmoderate expression: see section 17 weak expression: see section 01 02
temporal bone
moderate moderate
regionalmoderate expression: see section 17 18 weak expression: see section 01 02 19 21
orbito-sphenoid
moderate moderate
regionalmoderate expression: see section 17 18 weak expression: see section 01 02 05 06 19 22
viscerocranium
moderate moderate
regionalExpression in the turbinate bone.
clavicle
weak weak
regionalweak expression: see section 03 04 05 17
scapula
weak weak
regionalweak expression: see section 01 02 19 20
pelvic girdle skeleton
weak weak
regionalweak expression: see section 07 08 15 16 17
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T70213
Entity Detected:Mir93, microRNA 93 ( MGI:3619439)
Sequence:sense strand is shown

>T70213
CAAAGTGCTGTTCGTGCAGGTAG
Notes:The probe used by the EURExpress consortium to detect the presence of miRNA mmu-miR-93 was custom designed and ordered from Sigma-Exiqon by the EURExpress partner in Geneva and then distributed to the ISH generating units within the consortium.
Chemistry:LNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:19088 same embryo
 EMAGE:19086 same embryo
 EurExpress:euxassay_019428 same experiment
 MGI:4826382 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS