Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:19111

Mir763 microRNA 763 ( MGI:3691611)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:19111 EMAGE:19111 EMAGE:19111 EMAGE:19111 EMAGE:19111
"Pseudo-wholemount" of euxassay_019412. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_019412_01 euxassay_019412_02 euxassay_019412_03 euxassay_019412_04
EMAGE:19111 EMAGE:19111 EMAGE:19111 EMAGE:19111 EMAGE:19111
euxassay_019412_05 euxassay_019412_06 euxassay_019412_07 euxassay_019412_08 euxassay_019412_09
EMAGE:19111 EMAGE:19111 EMAGE:19111 EMAGE:19111 EMAGE:19111
euxassay_019412_10 euxassay_019412_11 euxassay_019412_12 euxassay_019412_13 euxassay_019412_14
EMAGE:19111 EMAGE:19111 EMAGE:19111 EMAGE:19111 EMAGE:19111
euxassay_019412_15 euxassay_019412_16 euxassay_019412_17 euxassay_019412_18 euxassay_019412_19
EMAGE:19111 EMAGE:19111 EMAGE:19111 EMAGE:19111 EMAGE:19111
euxassay_019412_20 euxassay_019412_21 euxassay_019412_22 euxassay_019412_23 euxassay_019412_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:19111Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
19111_wholemount_strong.wlz
19111_wholemount_moderate.wlz
19111_wholemount_weak.wlz
19111_wholemount_possible.wlz
19111_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:19111_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
humerus
moderate moderate
regionalmoderate expression: see section 01 02 03 04 21 22 23 24 weak expression: see section 05
fibula
moderate moderate
regionalmoderate expression: see section 02 03
tibia
moderate moderate
regionalmoderate expression: see section 02 03
femur
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 21 22 24 weak expression: see section 23
meckel's cartilage
moderate moderate
regionalmoderate expression: see section 04 05 06 07 16 19 20 weak expression: see section 08 09 10 11 13 14 15 18 21 22
axial skeleton
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 16 weak expression: see section 15
basioccipital bone
moderate moderate
regionalmoderate expression: see section 06 07 09 10 11 12 13 14 15 16 weak expression: see section 17
basisphenoid bone
moderate moderate
regionalmoderate expression: see section 11 12 13 14
exoccipital bone
weak weak
regionalweak expression: see section 04 05 19 20 21 22 23 24
temporal bone
weak weak
regionalweak expression: see section 01 02 03 04 21 22 23 24
orbito-sphenoid
moderate moderate
regionalmoderate expression: see section 08 weak expression: see section 05 06 07 20 21
viscerocranium
moderate moderate
regionalExpression in the turbinate bone.
scapula
moderate moderate
regionalmoderate expression: see section 02 03 04 21 22 23
pelvic girdle skeleton
moderate moderate
regionalmoderate expression: see section 10 11 17 18 20 weak expression: see section 09
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T70182
Entity Detected:Mir763, microRNA 763 ( MGI:3691611)
Sequence:sense strand is shown

>T70182
CCAGCTGGGAAGAACCAGTGGC
Notes:The probe used by the EURExpress consortium to detect the presence of miRNA mmu-miR-763 was custom designed and ordered from Sigma-Exiqon by the EURExpress partner in Geneva and then distributed to the ISH generating units within the consortium.
Chemistry:LNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:19112 same embryo
 EMAGE:19109 same embryo
 EMAGE:19113 same embryo
 EMAGE:19110 same embryo
 EurExpress:euxassay_019412 same experiment
 MGI:4826377 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS