Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:19145

Mir350 microRNA 350 ( MGI:3619366)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:19145 EMAGE:19145 EMAGE:19145 EMAGE:19145 EMAGE:19145
"Pseudo-wholemount" of euxassay_019424. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_019424_01 euxassay_019424_02 euxassay_019424_03 euxassay_019424_04
EMAGE:19145 EMAGE:19145 EMAGE:19145 EMAGE:19145 EMAGE:19145
euxassay_019424_05 euxassay_019424_06 euxassay_019424_07 euxassay_019424_08 euxassay_019424_09
EMAGE:19145 EMAGE:19145 EMAGE:19145 EMAGE:19145 EMAGE:19145
euxassay_019424_10 euxassay_019424_11 euxassay_019424_12 euxassay_019424_13 euxassay_019424_14
EMAGE:19145 EMAGE:19145 EMAGE:19145 EMAGE:19145 EMAGE:19145
euxassay_019424_15 euxassay_019424_16 euxassay_019424_17 euxassay_019424_18 euxassay_019424_19
EMAGE:19145 EMAGE:19145 EMAGE:19145 EMAGE:19145
euxassay_019424_20 euxassay_019424_21 euxassay_019424_22 euxassay_019424_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:19145Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
19145_wholemount_strong.wlz
19145_wholemount_moderate.wlz
19145_wholemount_weak.wlz
19145_wholemount_possible.wlz
19145_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:19145_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
rib
strong strong
regionalstrong expression: see section 06 moderate expression: see section 01 02 05 07 08 20 21 weak expression: see section 03 04 16 17 18 19 22 23
humerus
strong strong
regionalstrong expression: see section 01 02 03 04 moderate expression: see section 20 21 22 23
hindlimb digit 2 phalanx
weak weak
regionalweak expression: see section 07
hindlimb digit 3 phalanx
weak weak
regionalweak expression: see section 07
hindlimb digit 4 phalanx
weak weak
regionalweak expression: see section 07
foot mesenchyme
moderate moderate
regionalmoderate expression: see section 06
fibula
moderate moderate
regionalmoderate expression: see section 02 03 04
tibia
moderate moderate
regionalmoderate expression: see section 03 04
femur
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 weak expression: see section 08 20 21 22 23
otic capsule
weak weak
regionalweak expression: see section 07 08
meckel's cartilage
strong strong
regionalstrong expression: see section 02 03 04 05 06 moderate expression: see section 07 08 21 weak expression: see section 17 18 19 20
axial skeleton
strong strong
regionalstrong expression: see section 05 06 moderate expression: see section 07 08 weak expression: see section 09 10 13 14 16
basioccipital bone
moderate moderate
regionalmoderate expression: see section 06 07 08 weak expression: see section 09 13 14
basisphenoid bone
weak weak
regionalweak expression: see section 13 14
exoccipital bone
moderate moderate
regionalmoderate expression: see section 01 02
temporal bone
moderate moderate
regionalmoderate expression: see section 01 02 weak expression: see section 20
orbito-sphenoid
moderate moderate
regionalmoderate expression: see section 01 02 06 07 08 weak expression: see section 20
viscerocranium
weak weak
regionalExpression in the turbinate bone.
scapula
strong strong
regionalstrong expression: see section 01 02 20 moderate expression: see section 03 04 21 weak expression: see section 22
pelvic girdle skeleton
weak weak
regionalweak expression: see section 10 11 18
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T70433
Entity Detected:Mir350, microRNA 350 ( MGI:3619366)
Sequence:sense strand is shown

>T70433
TTCACAAAGCCCATACACTTTC
Notes:The probe used by the EURExpress consortium to detect the presence of miRNA mmu-miR-350 was custom designed and ordered from Sigma-Exiqon by the EURExpress partner in Geneva and then distributed to the ISH generating units within the consortium.
Chemistry:LNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:19146 same embryo
 EurExpress:euxassay_019424 same experiment
 MGI:4826277 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS