Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:19148

Mir375 microRNA 375 ( MGI:3619376)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:19148 EMAGE:19148 EMAGE:19148 EMAGE:19148 EMAGE:19148
"Pseudo-wholemount" of euxassay_019407. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_019407_01 euxassay_019407_02 euxassay_019407_03 euxassay_019407_04
EMAGE:19148 EMAGE:19148 EMAGE:19148 EMAGE:19148 EMAGE:19148
euxassay_019407_05 euxassay_019407_06 euxassay_019407_07 euxassay_019407_08 euxassay_019407_09
EMAGE:19148 EMAGE:19148 EMAGE:19148 EMAGE:19148 EMAGE:19148
euxassay_019407_10 euxassay_019407_11 euxassay_019407_12 euxassay_019407_13 euxassay_019407_14
EMAGE:19148 EMAGE:19148 EMAGE:19148 EMAGE:19148 EMAGE:19148
euxassay_019407_15 euxassay_019407_16 euxassay_019407_17 euxassay_019407_18 euxassay_019407_19
EMAGE:19148 EMAGE:19148 EMAGE:19148 EMAGE:19148 EMAGE:19148
euxassay_019407_20 euxassay_019407_21 euxassay_019407_22 euxassay_019407_23 euxassay_019407_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:19148Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
19148_wholemount_strong.wlz
19148_wholemount_moderate.wlz
19148_wholemount_weak.wlz
19148_wholemount_possible.wlz
19148_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:19148_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
rib
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07 16 17 18 19 21
humerus
weak weak
regionalweak expression: see section 01 02 03 21 22 23
fibula
weak weak
regionalweak expression: see section 01 02
tibia
weak weak
regionalweak expression: see section 01 02
femur
moderate moderate
regionalmoderate expression: see section 04 05 21 weak expression: see section 01 02 03 19 22
pancreas
weak weak
regionalweak expression: see section 08 09 10 14
hyoid
weak weak
regionalweak expression: see section 10 11 13 14
meckel's cartilage
weak weak
regionalweak expression: see section 02 03 04 05 06 07 09 10 11 12 13 15 16 18 19
axial skeleton
moderate moderate
regionalmoderate expression: see section 09 10 13 14 weak expression: see section 05 06 07 08 11 12 15
basioccipital bone
moderate moderate
regionalmoderate expression: see section 09 10 13 16 weak expression: see section 05 06 07 08 11 12 14 15
basisphenoid bone
moderate moderate
regionalmoderate expression: see section 09 10 13 weak expression: see section 11 12
clavicle
weak weak
regionalweak expression: see section 17 18
scapula
weak weak
regionalweak expression: see section 01 02 03 20 21
pelvic girdle skeleton
moderate moderate
regionalmoderate expression: see section 14 weak expression: see section 06 07 08 15
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T70445
Entity Detected:Mir375, microRNA 375 ( MGI:3619376)
Sequence:sense strand is shown

>T70445
TTTGTTCGTTCGGCTCGCGTGA
Notes:The probe used by the EURExpress consortium to detect the presence of miRNA mmu-miR-375 was custom designed and ordered from Sigma-Exiqon by the EURExpress partner in Geneva and then distributed to the ISH generating units within the consortium.
Chemistry:LNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:19153 same embryo
 EMAGE:19152 same embryo
 EMAGE:19147 same embryo
 EMAGE:19150 same embryo
 EMAGE:19151 same embryo
 EMAGE:19149 same embryo
 EurExpress:euxassay_019407 same experiment
 MGI:4826278 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS