Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:19149

Mir34b microRNA 34b ( MGI:3619364)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:19149 EMAGE:19149 EMAGE:19149 EMAGE:19149 EMAGE:19149
"Pseudo-wholemount" of euxassay_019445. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_019445_01 euxassay_019445_02 euxassay_019445_03 euxassay_019445_04
EMAGE:19149 EMAGE:19149 EMAGE:19149 EMAGE:19149 EMAGE:19149
euxassay_019445_05 euxassay_019445_06 euxassay_019445_07 euxassay_019445_08 euxassay_019445_09
EMAGE:19149 EMAGE:19149 EMAGE:19149 EMAGE:19149 EMAGE:19149
euxassay_019445_10 euxassay_019445_11 euxassay_019445_12 euxassay_019445_13 euxassay_019445_14
EMAGE:19149 EMAGE:19149 EMAGE:19149 EMAGE:19149 EMAGE:19149
euxassay_019445_15 euxassay_019445_16 euxassay_019445_17 euxassay_019445_18 euxassay_019445_19
EMAGE:19149 EMAGE:19149 EMAGE:19149 EMAGE:19149 EMAGE:19149
euxassay_019445_20 euxassay_019445_21 euxassay_019445_22 euxassay_019445_23 euxassay_019445_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:19149Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
19149_wholemount_strong.wlz
19149_wholemount_moderate.wlz
19149_wholemount_weak.wlz
19149_wholemount_possible.wlz
19149_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:19149_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
rib
strong strong
regionalstrong expression: see section 05 06 07 moderate expression: see section 01 02 03 04 15 16 17 21 22 23 weak expression: see section 18 19 20 24
humerus
strong strong
regionalstrong expression: see section 01 02 03 04 23 moderate expression: see section 20 21 22 weak expression: see section 24
hindlimb digit 1 phalanx
weak weak
regionalweak expression: see section 06
hindlimb digit 2 phalanx
weak weak
regionalweak expression: see section 05 06
hindlimb digit 3 phalanx
weak weak
regionalweak expression: see section 05 06
hindlimb digit 4 phalanx
weak weak
regionalweak expression: see section 05 06
hindlimb digit 5 phalanx
weak weak
regionalweak expression: see section 06
fibula
strong strong
regionalstrong expression: see section 01 moderate expression: see section 02 03 weak expression: see section 24
tibia
strong strong
regionalstrong expression: see section 01 moderate expression: see section 02 weak expression: see section 24
femur
strong strong
regionalstrong expression: see section 01 moderate expression: see section 02 03 04 05 weak expression: see section 19 20 21 22 23
otic capsule
moderate moderate
regionalmoderate expression: see section 08 15 weak expression: see section 07 16
neural retina
weak weak
regionalweak expression: see section 01 02 22 23 24
hyoid
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15
meckel's cartilage
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 09 moderate expression: see section 10 11 12 13 14 15 16 17 18 19 20 21
axial skeleton
strong strong
regionalstrong expression: see section 06 07 08 09 10 13 moderate expression: see section 11 12 14 15 16
basioccipital bone
strong strong
regionalstrong expression: see section 09 10 11 13 moderate expression: see section 08 12 14 15 16 17
basisphenoid bone
strong strong
regionalstrong expression: see section 09 10 11 13 moderate expression: see section 08 12 14 15
exoccipital bone
moderate moderate
regionalmoderate expression: see section 01 02 03 04 18 19
temporal bone
strong strong
regionalstrong expression: see section 05 moderate expression: see section 01 02 03 04 18 19 21 22
orbito-sphenoid
strong strong
regionalstrong expression: see section 05 moderate expression: see section 01 06 17 18 19
viscerocranium
moderate moderate
regionalExpression in the turbinate bone.
clavicle
weak weak
regionalweak expression: see section 07 08 17 18 19
scapula
moderate moderate
regionalmoderate expression: see section 20 21 22
pelvic girdle skeleton
moderate moderate
regionalmoderate expression: see section 07 08 15 weak expression: see section 06
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T70430
Entity Detected:Mir34b, microRNA 34b ( MGI:3619364)
Sequence:sense strand is shown

>T70430
AATCACTAACTCCACTGCCATC
Notes:The probe used by the EURExpress consortium to detect the presence of miRNA mmu-miR-34b-3p was custom designed and ordered from Sigma-Exiqon by the EURExpress partner in Geneva and then distributed to the ISH generating units within the consortium.
Chemistry:LNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:19153 same embryo
 EMAGE:19152 same embryo
 EMAGE:19147 same embryo
 EMAGE:19148 same embryo
 EMAGE:19150 same embryo
 EMAGE:19151 same embryo
 EurExpress:euxassay_019445 same experiment
 MGI:4826275 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS