Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:19191

Unc45a unc-45 homolog A (C. elegans) ( MGI:2142246)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:19191 EMAGE:19191 EMAGE:19191 EMAGE:19191 EMAGE:19191
"Pseudo-wholemount" of euxassay_009140. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_009140_01 euxassay_009140_02 euxassay_009140_03 euxassay_009140_04
EMAGE:19191 EMAGE:19191 EMAGE:19191 EMAGE:19191 EMAGE:19191
euxassay_009140_05 euxassay_009140_06 euxassay_009140_07 euxassay_009140_08 euxassay_009140_09
EMAGE:19191 EMAGE:19191 EMAGE:19191 EMAGE:19191 EMAGE:19191
euxassay_009140_10 euxassay_009140_11 euxassay_009140_12 euxassay_009140_13 euxassay_009140_14
EMAGE:19191 EMAGE:19191 EMAGE:19191 EMAGE:19191 EMAGE:19191
euxassay_009140_15 euxassay_009140_16 euxassay_009140_17 euxassay_009140_18 euxassay_009140_19
EMAGE:19191 EMAGE:19191 EMAGE:19191 EMAGE:19191 EMAGE:19191
euxassay_009140_20 euxassay_009140_21 euxassay_009140_22 euxassay_009140_23 euxassay_009140_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:19191Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
19191_wholemount_strong.wlz
19191_wholemount_moderate.wlz
19191_wholemount_weak.wlz
19191_wholemount_possible.wlz
19191_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:19191_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
body cavity or lining
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
limb
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
mesenchyme
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
vertebral axis musculature
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
gland
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
alimentary system
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 17 18 19 20 21 22 23 24
nervous system
weak weak
single cellweak expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
integumental system
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
diencephalon meninges
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
telencephalon meninges
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
medulla oblongata floor plate
strong strong
regionalstrong expression: see section 11
hindbrain meninges
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
metencephalon floor plate
strong strong
regionalstrong expression: see section 11
midbrain meninges
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 20
midbrain lateral wall
moderate moderate
regionalmoderate expression: see section 19
spinal cord floor plate
strong strong
regionalstrong expression: see section 10 12 13 14
spinal cord meninges
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14 15 16
sensory organ system
weak weak
single cellweak expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
cardiovascular system
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
urinary system
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
reproductive system
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
respiratory system
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
tail
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T2453
Entity Detected:Unc45a, unc-45 homolog A (C. elegans) ( MGI:2142246)
Sequence:sense strand is shown

>T2453
TGGCCTCGAGCCAGATTCGGACGAGGCAGGCCCTGCTCCTCAGCCCCAACCAGGAGCTGCAGCACCGGGG
CACCGTGGTGGTGCTGAACATGATGCAGTCTTCGAAGGAGATCGCCGGCACCCTGATGGAGAGTGAGGTC
CTGGAGATCCTGTCAGTGTTGGCCAAGGGCGAGGAGAGCCCAGTCACCAGGGCTGCCGCAGCCTGCCTGG
AGAAAGCAGTGGAATATAGACTCATCCAACCCAACCAGGACGGAGAGTGACGATCGGCCCGGGGCCCACA
GCTCACGCATCTGTCACCCTTCACAGCTCTGAGTCAGCACTGGGATGCTCGATACTTGCCTCGCCTCCAC
AGCTGCCACAGTTGCACTTTGGTGTTCTCAGGACACACAGCATACAGCCCTGCCCTGCCAGCACTCAGGA
GGGCCCTGTCTGTACTGTAGAGAGCTGAGGCTGGGGGACGTACATCCCATTCAAGCCTGAGGATTATGGG
CATCAAGAAGGAAGGACACAACAGCATCCTCACATGCTGGGAGCATCATCAGAGCCTG
Notes:The probe template was PCR amplified from IMAGE:1247704 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1247704 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:19194 same embryo
 EMAGE:19193 same embryo
 EMAGE:19195 same embryo
 EMAGE:19192 same embryo
 EurExpress:euxassay_009140 same experiment
 MGI:4829098 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS