Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:19192

Mcm2 minichromosome maintenance deficient 2 mitotin (S. cerevisiae) ( MGI:105380)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:19192 EMAGE:19192 EMAGE:19192 EMAGE:19192 EMAGE:19192
"Pseudo-wholemount" of euxassay_009158. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_009158_01 euxassay_009158_02 euxassay_009158_03 euxassay_009158_04
EMAGE:19192 EMAGE:19192 EMAGE:19192 EMAGE:19192 EMAGE:19192
euxassay_009158_05 euxassay_009158_06 euxassay_009158_07 euxassay_009158_08 euxassay_009158_09
EMAGE:19192 EMAGE:19192 EMAGE:19192 EMAGE:19192 EMAGE:19192
euxassay_009158_10 euxassay_009158_11 euxassay_009158_12 euxassay_009158_13 euxassay_009158_14
EMAGE:19192 EMAGE:19192 EMAGE:19192 EMAGE:19192 EMAGE:19192
euxassay_009158_15 euxassay_009158_16 euxassay_009158_17 euxassay_009158_18 euxassay_009158_19
EMAGE:19192 EMAGE:19192 EMAGE:19192 EMAGE:19192
euxassay_009158_20 euxassay_009158_21 euxassay_009158_22 euxassay_009158_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:19192Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
19192_wholemount_strong.wlz
19192_wholemount_moderate.wlz
19192_wholemount_weak.wlz
19192_wholemount_possible.wlz
19192_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:19192_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
body cavity or lining
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
limb
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
mesenchyme
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
vertebral axis musculature
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
gland
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
visceral organ system
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
brain
strong strong
single cellstrong expression: see section 02 03 04 05 06 07 09 10 11 12 13 14 15 16 17 18 19 20 21 22
integumental system
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
diencephalon lateral wall ventricular layer
strong strong
regionalstrong expression: see section 10 11 12 13 14 15 16
telencephalon ventricular layer
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
medulla oblongata alar plate ventricular layer
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16
medulla oblongata basal plate ventricular layer
strong strong
regionalstrong expression: see section 08 09 10 11 12
rest of cerebellum ventricular layer
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19
pons ventricular layer
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19
midbrain ventricular layer
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 13 14 15 16
central nervous system nerve
strong strong
single cellstrong expression: see section 08
spinal cord
strong strong
single cellstrong expression: see section 07 09 10 11 12 13 14
spinal cord ventricular layer
strong strong
regionalstrong expression: see section 09 10 11 12 13 14
sensory organ system
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
cardiovascular system
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
tail
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T2455
Entity Detected:Mcm2, minichromosome maintenance deficient 2 mitotin (S. cerevisiae) ( MGI:105380)
Sequence:sense strand is shown

>T2455
GCAACGGGCAGCATTCCCATCACGGTGCGCCACATCGAGTCCATGATCCGCATGGCCGAGGCCCATGCCC
GCATGCACCTGCGGGACTACGTGATGGAAGACGATGTCAACATGGCCATCCGAGTGATGATGGAGAGCTT
CATTGACACCCAGAAGTTCAGCGTCATGCGGAGTATGCGCAAGACTTTTGCCCGGTATCTCTCCTTCCGG
CGAGATAACAATGATCTGCTGCTCTTCATACTGAAGCAGTTGGTGGCTGAGCAGGTGACATATCAACGCA
ACCGCTTTGGGGCCCAGCAGGACACCATTGAAATACCTGAGAAGGATCTGATGGACAAGGCCAGGCAGAT
CAATATTCACAACCTCTCTGCCTTCTACGACAGCGACCTCTTCAAATTCAACAAGTTCAGCCGTGACCTG
AAACGCAAACTGATCCTACAGCAGTTCTGAGACCAGCACAGGGGCCTCTATGTCTGAATGAGGCTCGGTC
ACCACGCTGAGCCTACGTCACTTCCCACTTCCACTGGGGCTTGG
Notes:The probe template was PCR amplified from IMAGE:1247769 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1247769 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:19194 same embryo
 EMAGE:19191 same embryo
 EMAGE:19193 same embryo
 EMAGE:19195 same embryo
 EurExpress:euxassay_009158 same experiment
 MGI:4826127 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS