Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:19238

Slc20a1 solute carrier family 20, member 1 ( MGI:108392)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:19238 EMAGE:19238 EMAGE:19238 EMAGE:19238 EMAGE:19238
"Pseudo-wholemount" of euxassay_009182. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_009182_01 euxassay_009182_02 euxassay_009182_03 euxassay_009182_04
EMAGE:19238 EMAGE:19238 EMAGE:19238 EMAGE:19238 EMAGE:19238
euxassay_009182_05 euxassay_009182_06 euxassay_009182_07 euxassay_009182_08 euxassay_009182_09
EMAGE:19238 EMAGE:19238 EMAGE:19238 EMAGE:19238 EMAGE:19238
euxassay_009182_10 euxassay_009182_11 euxassay_009182_12 euxassay_009182_13 euxassay_009182_14
EMAGE:19238 EMAGE:19238 EMAGE:19238 EMAGE:19238 EMAGE:19238
euxassay_009182_15 euxassay_009182_16 euxassay_009182_17 euxassay_009182_18 euxassay_009182_19
EMAGE:19238 EMAGE:19238 EMAGE:19238
euxassay_009182_20 euxassay_009182_21 euxassay_009182_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:19238Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
19238_wholemount_strong.wlz
19238_wholemount_moderate.wlz
19238_wholemount_weak.wlz
19238_wholemount_possible.wlz
19238_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:19238_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 07 08 14 15 16
brain
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
cerebral cortex marginal layer
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 04 05 18 19
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 06 16
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 16 17 18 19 20 21
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 06 15
spinal cord
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14
cervico-thoracic ganglion
moderate moderate
regionalmoderate expression: see section 07 11
cervical ganglion
moderate moderate
regionalmoderate expression: see section 07 14 15
thoracic ganglion
moderate moderate
regionalmoderate expression: see section 08 09 10 11
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 06 07 08 09 12 13 14 15
midgut
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 13 14 15
liver
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
metanephros
moderate moderate
regionalmoderate expression: see section 04
renal cortex
moderate moderate
regionalmoderate expression: see section 05
maturing glomerular tuft
moderate moderate
regionalmoderate expression: see section 06 07 13 14 15
seminiferous cord
moderate moderate
regionalmoderate expression: see section 03 04 05 06 15 16 17
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T2542
Entity Detected:Slc20a1, solute carrier family 20, member 1 ( MGI:108392)
Sequence:sense strand is shown

>T2542
TGNCCTCGAGGNCAGATTCGGACGAGGAATATGACTTATCTCAAATTAGCTATGTAAAATAGCCAGGTTT
CCATTGATTCATTCCAAGGTCCCTTTTCTCCTGGGCTATGAATTCCTGTACATATTTCTCTACTTTTGTA
TCAGGCCTCAATTCCAGTATGTTTTAATGTTGTCTGTGAGATAACTTAGGTGGGTTCTTTTTAAACAGCC
AGGCAGAGCCATTTGATGGCATGTACTGCTTTGTCGGCCTCACCAGCTTCTTCCCCAACATGCACAGGGA
TTTAACAACATGTAACTGAAGCTTCCCTCCCTCATAGTCTCTCATAGAAATAGTCACGGCACTCTGCTCC
CTGTCACTAGTGGCAGGTTCTGTTGATGTGTGACAACTTCTTAGAGGGCCGAGAATCTTTGGCACAGTGG
AAATATAAGTTTGTAGTAACCTCTTTGCAAACAGTTCACGGACATGTTGCTAAGAAGCAGGGAGACAAAG
CCCCCTGGCGGTTGTGGTTATTCTTCTGAGATTTCTGGCAGTGTGGGATGGGTGAA
Notes:The probe template was PCR amplified from IMAGE:1382127 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1382127 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:19234 same embryo
 EMAGE:19235 same embryo
 EMAGE:19236 same embryo
 EMAGE:19237 same embryo
 EMAGE:19239 same embryo
 EurExpress:euxassay_009182 same experiment
 MGI:4828130 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS