Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:19246

Slc38a7 solute carrier family 38, member 7 ( MGI:2679005)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:19246 EMAGE:19246 EMAGE:19246 EMAGE:19246 EMAGE:19246
"Pseudo-wholemount" of euxassay_002038. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_002038_01 euxassay_002038_02 euxassay_002038_03 euxassay_002038_04
EMAGE:19246 EMAGE:19246 EMAGE:19246 EMAGE:19246 EMAGE:19246
euxassay_002038_05 euxassay_002038_06 euxassay_002038_07 euxassay_002038_08 euxassay_002038_09
EMAGE:19246 EMAGE:19246 EMAGE:19246 EMAGE:19246 EMAGE:19246
euxassay_002038_10 euxassay_002038_11 euxassay_002038_12 euxassay_002038_13 euxassay_002038_14
EMAGE:19246 EMAGE:19246 EMAGE:19246 EMAGE:19246 EMAGE:19246
euxassay_002038_15 euxassay_002038_16 euxassay_002038_17 euxassay_002038_18 euxassay_002038_19
EMAGE:19246 EMAGE:19246 EMAGE:19246 EMAGE:19246 EMAGE:19246
euxassay_002038_20 euxassay_002038_21 euxassay_002038_22 euxassay_002038_23 euxassay_002038_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:19246Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
19246_wholemount_strong.wlz
19246_wholemount_moderate.wlz
19246_wholemount_weak.wlz
19246_wholemount_possible.wlz
19246_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:19246_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
hand mesenchyme
strong strong
regionalstrong expression: see section 01 02 07 08 09 10 20 21 22 23 24
foot mesenchyme
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 21 22 23 24
head mesenchyme
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 17 18 19 20 21 22
vibrissa
strong strong
regionalstrong expression: see section 04 05 06 07 08 19 20 21 22 23
lateral ventricle choroid plexus
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17
4th ventricle lateral recess
strong strong
regionalstrong expression: see section 02 03 04 moderate expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19
dorsal grey horn
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10
naris
moderate moderate
regionalmoderate expression: see section 12 13
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 08 09 10 11
nasal septum
moderate moderate
regionalmoderate expression: see section 13 14
lower lip
strong strong
regionalstrong expression: see section 09 10 11 12 13 14 15 16 17
lower jaw incisor
strong strong
regionalstrong expression: see section 09 10 11 12 13 14 15 16 17
lower jaw molar
strong strong
regionalstrong expression: see section 06 07 18 19
oral epithelium
moderate moderate
regionalmoderate expression: see section 10 13 14 15 16 17
upper lip
strong strong
regionalstrong expression: see section 08 09 10 11 12 13 14 15 16 17 18 19
upper jaw incisor
strong strong
regionalstrong expression: see section 09 10 11 12 13 14 15 16 17
upper jaw molar
strong strong
regionalstrong expression: see section 06 07 18 19
lung
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 moderate expression: see section 08 09 10 11 12 13 14 15 16 17 18
trachea
moderate moderate
regionalmoderate expression: see section 11 12
pectoral girdle and thoracic body wall skeleton
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T2525
Entity Detected:Slc38a7, solute carrier family 38, member 7 ( MGI:2679005)
Sequence:sense strand is shown

>T2525
TGGCCTCGAGCCAGAATTCGGACGAGGCCCCTGCTCCTTTTGTAAGTCCCAAGTACAGAATTGGTCTTTA
TAAATCTATTCTGTCTAAAACACTTATCCTAGGAGTGAAAGGGACCCTTCCCAGCAGACTACCCCCTGCC
CCCAACACAGGTCAGTCCTGTTGAGGCAGGAGGCTTAGCATCCAGACTTGCTGAATTGTTGTTCTCCCAT
CCATCCCTGGTACTTCTGGTCCCGCTACACTGTTTTCCCCTAGCCCCCCAACCCCCATAAGCCTCCAAGT
GCTGCCTTTCACAGTGACCAATCACAGAGCTGGGCATGGCTTAGAGACGTGCTAGCTGGGACAGTTGGCT
AGAACCAGGCTTCAGCTTGTCCTCAGGACCCCCTTCCTCCGTCCCCTTTGCCCTCTGTATCCAGTTTCTT
GCTGGTTCTTTTCTACTCAAGCACACTTGGAGACGTGAGGATGATTAATAAAGGGACTTACACTGCTAAA
AAAAAAAAAAAA
Notes:The probe template was PCR amplified from IMAGE:1381843 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1381843 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:19247 same embryo
 EurExpress:euxassay_002038 same experiment
 MGI:4828218 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS