Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:19268

Rqcd1 rcd1 (required for cell differentiation) homolog 1 (S. pombe) ( MGI:1928902)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:19268 EMAGE:19268 EMAGE:19268 EMAGE:19268 EMAGE:19268
"Pseudo-wholemount" of euxassay_001882. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_001882_01 euxassay_001882_02 euxassay_001882_03 euxassay_001882_04
EMAGE:19268 EMAGE:19268 EMAGE:19268 EMAGE:19268 EMAGE:19268
euxassay_001882_05 euxassay_001882_06 euxassay_001882_07 euxassay_001882_08 euxassay_001882_09
EMAGE:19268 EMAGE:19268 EMAGE:19268 EMAGE:19268 EMAGE:19268
euxassay_001882_10 euxassay_001882_11 euxassay_001882_12 euxassay_001882_13 euxassay_001882_14
EMAGE:19268 EMAGE:19268 EMAGE:19268 EMAGE:19268 EMAGE:19268
euxassay_001882_15 euxassay_001882_16 euxassay_001882_17 euxassay_001882_18 euxassay_001882_19
EMAGE:19268 EMAGE:19268
euxassay_001882_20 euxassay_001882_21

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:19268Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
19268_wholemount_strong.wlz
19268_wholemount_moderate.wlz
19268_wholemount_weak.wlz
19268_wholemount_possible.wlz
19268_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:19268_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
thymus primordium
weak weak
regionalweak expression: see section 12 13 14 15 16
olfactory cortex ventricular layer
strong strong
homogeneousstrong expression: see section 11 12 16 17
telencephalon ventricular layer
strong strong
homogeneousstrong expression: see section 03 04 05 06 07 08 09 10 11 12 13 15 16 17 18 19 20 21
midbrain ventricular layer
strong strong
regionalstrong expression: see section 09 10 11 12 13 14 15 16 17
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 12 13 16 moderate expression: see section 09 10 11 15 17 18
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T2389
Entity Detected:Rqcd1, rcd1 (required for cell differentiation) homolog 1 (S. pombe) ( MGI:1928902)
Sequence:sense strand is shown

>T2389
TGGCCTCGAGNCAGATTCGGACGAGGAGCAGGTGTCTTAATTTACTCAACCTTCCCTAAAAGAGAATTGT
ATTGGGGCAGGAGGGATCGCAGTTCTTCAAATTCAGGTCTTCGAAGATAATTTCCAGGTGTCTTCTCAAA
CGGAGTAAGCGCCTGGATCCAAATGGTAGACTACTTGACCCCGTTCTCTAGCGTGAGTTTTCATAGTGCC
ATCTCCTCATGATTGTAGAAGCAGCTGAATGAGTTTCTTCAGATTTAAAATGAATAGCTGGACTCTGCTG
GCTCAGTCTCCTCTCCTTTTTAACACACTTTCTTAGGTCTATGGAAACTACAGGGTTGCCACTGAAATGT
TTTTTTACTTGTTGATAGTGTCAGGGCCCCCCTTCCATCCCCATGGGCTTGACTCTCAACCTGTTACTGT
AAACTGCGATCCTTCCCACCGTCAGCCTTTGTTTCTCATCCTCACCTCCAAAGATGGGATTATTAATCCA
ACTCTAGAAAGAGTCCAAATCTTCAGCCCGTGTCTCATACACTTGAAGATGTCTATATTGAGTTTGAAGA
GGT
Notes:The probe template was PCR amplified from IMAGE:1195354 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1195354 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:MGI:4827813 same experiment
 EurExpress:euxassay_001882 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS