Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:19301

Cd9 CD9 antigen ( MGI:88348)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:19301 EMAGE:19301 EMAGE:19301 EMAGE:19301 EMAGE:19301
"Pseudo-wholemount" of euxassay_001933. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_001933_01 euxassay_001933_02 euxassay_001933_03 euxassay_001933_04
EMAGE:19301 EMAGE:19301 EMAGE:19301 EMAGE:19301 EMAGE:19301
euxassay_001933_05 euxassay_001933_06 euxassay_001933_07 euxassay_001933_08 euxassay_001933_09
EMAGE:19301 EMAGE:19301 EMAGE:19301 EMAGE:19301 EMAGE:19301
euxassay_001933_10 euxassay_001933_11 euxassay_001933_12 euxassay_001933_13 euxassay_001933_14
EMAGE:19301 EMAGE:19301 EMAGE:19301 EMAGE:19301 EMAGE:19301
euxassay_001933_15 euxassay_001933_16 euxassay_001933_17 euxassay_001933_18 euxassay_001933_19
EMAGE:19301 EMAGE:19301 EMAGE:19301 EMAGE:19301 EMAGE:19301
euxassay_001933_20 euxassay_001933_21 euxassay_001933_22 euxassay_001933_23 euxassay_001933_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:19301Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
19301_wholemount_strong.wlz
19301_wholemount_moderate.wlz
19301_wholemount_weak.wlz
19301_wholemount_possible.wlz
19301_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:19301_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
thymus primordium
weak weak
regionalweak expression: see section 09 10 11 12
submandibular gland primordium
strong strong
regionalstrong expression: see section 05 06 07 14 15 16 17
foregut-midgut junction
moderate moderate
regionalmoderate expression: see section 10 11
vibrissa
strong strong
regionalstrong expression: see section 05 06 07 19 20 21 22 moderate expression: see section 03
diencephalon lateral wall ventricular layer
strong strong
regionalstrong expression: see section 11 12 13
olfactory cortex ventricular layer
moderate moderate
homogeneousmoderate expression: see section 11 15 16
telencephalon ventricular layer
moderate moderate
homogeneousmoderate expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
medulla oblongata alar plate ventricular layer
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 13 14
medulla oblongata basal plate ventricular layer
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 13 14
rest of cerebellum ventricular layer
strong strong
regionalstrong expression: see section 05 06 15 16 17 moderate expression: see section 03 04
pons ventricular layer
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 13 14 15 16
midbrain ventricular layer
strong strong
regionalstrong expression: see section 08 09 10 11 12 13 14 15 moderate expression: see section 07
ventral grey horn
strong strong
regionalstrong expression: see section 09 10 11 12 moderate expression: see section 08
cervico-thoracic ganglion
strong strong
regionalstrong expression: see section 07 13
cervical ganglion
strong strong
regionalstrong expression: see section 07 14
thoracic ganglion
strong strong
regionalstrong expression: see section 11 12
pharyngo-tympanic tube
strong strong
regionalstrong expression: see section 01 02 03 21 22 23 24
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 08 09 10 11 14 15 16 17 19
esophagus
strong strong
regionalstrong expression: see section 10 11 12
stomach
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 moderate expression: see section 08 09
hindgut
moderate moderate
regionalmoderate expression: see section 11
rectum
strong strong
regionalstrong expression: see section 11
midgut
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14
oral epithelium
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
bladder
strong strong
regionalstrong expression: see section 11 12
kidney calyx
strong strong
regionalstrong expression: see section 05 06 07 17 18
kidney pelvis
strong strong
regionalstrong expression: see section 08 09 15 16
urethra of male
strong strong
regionalstrong expression: see section 11 12
lung
moderate moderate
spottedmoderate expression: see section 02 03 04 05 06 07 08 11 12 13 14 15 16 17 18 19 20
axial skeleton
moderate moderate
regionalmoderate expression: see section 11 12
nucleus pulposus
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T610
Entity Detected:Cd9, CD9 antigen ( MGI:88348)
Sequence:sense strand is shown

>T610
TCCTCGAGNCTGTTGGCCTACTGGGGAGGCCAGCCCCTAGCCGCAGCGTGTCTCAGTCGGTTGTCGAGTC
CCTTCTGTCCCAGTCGTTCGTGCCTCTTGTCCCACGCAACTCCAGCTTGTACCATGCCGGTCAAAGGAGG
TAGCAAGTGCATCAAATACCTGCTCTTCGGATTTAACTTCATCTTCTGGCTCGCTGGCATTGCAGTGCTT
GCTATTGGACTATGGCTCCGATTCGACTCTCAGACCAAGAGCATCTTCGAGCAAGAGAATAACCATTCCA
GTTTCTACACAGGAGTGTACATTCTGATTGGAGCCGGGGCCCTCATGATGCTGGTTGGTTTCCTGGGCTG
CTGTGGAGCTGTACAAGAGTCCCAGTGCATGCTGGGATTGTTCTTCGGGTTCCTCTTGGTGATATTCGCC
ATTGAGATAGCCGCCGCCGTCTGGGGCTATACCCACAAGGATGAGGTGATTAAAGAACTCCAGGAGTTTT
ACAAGGACACCTACCAAAAGTTACGGAGCAAGGATGAACCCCAGCGGGAAACACTCA
Notes:The probe template was PCR amplified from IMAGE:1885943 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1885943 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:19302 same embryo
 EMAGE:19300 same embryo
 EMAGE:19299 same embryo
 EurExpress:euxassay_001933 same experiment
 MGI:4823746 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS