Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:19322

Cmtm8 CKLF-like MARVEL transmembrane domain containing 8 ( MGI:2447167)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:19322 EMAGE:19322 EMAGE:19322 EMAGE:19322 EMAGE:19322
"Pseudo-wholemount" of euxassay_004903. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_004903_01 euxassay_004903_02 euxassay_004903_03 euxassay_004903_04
EMAGE:19322 EMAGE:19322 EMAGE:19322 EMAGE:19322 EMAGE:19322
euxassay_004903_05 euxassay_004903_06 euxassay_004903_07 euxassay_004903_08 euxassay_004903_09
EMAGE:19322 EMAGE:19322 EMAGE:19322 EMAGE:19322 EMAGE:19322
euxassay_004903_10 euxassay_004903_11 euxassay_004903_12 euxassay_004903_13 euxassay_004903_14
EMAGE:19322 EMAGE:19322 EMAGE:19322 EMAGE:19322
euxassay_004903_15 euxassay_004903_16 euxassay_004903_17 euxassay_004903_18

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:19322Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
19322_wholemount_strong.wlz
19322_wholemount_moderate.wlz
19322_wholemount_weak.wlz
19322_wholemount_possible.wlz
19322_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:19322_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
thymus primordium
moderate moderate
regionalmoderate expression: see section 10 12
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 08 09 weak expression: see section 14 15 16
pancreas
moderate moderate
regionalmoderate expression: see section 09 10 12
thyroid gland
weak weak
regionalweak expression: see section 10 12
adenohypophysis
weak weak
regionalweak expression: see section 10 11 12 13
medulla oblongata basal plate ventricular layer
strong strong
regionalstrong expression: see section 11
pons ventricular layer
strong strong
regionalstrong expression: see section 11
spinal cord ventricular layer
strong strong
regionalstrong expression: see section 11
inner ear
weak weak
regionalweak expression: see section 05 06 07 08 09 14 15 16 17 18
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 09 10 11 13 14 15 16
nasal cavity respiratory epithelium
moderate moderate
regionalmoderate expression: see section 11 13
pharynx
weak weak
regionalweak expression: see section 10 11 12
stomach
weak weak
regionalweak expression: see section 02 03 04 05 06 07 08 09
midgut
moderate moderate
regionalmoderate expression: see section 12 weak expression: see section 09 10 11 13 14 15
metanephros
weak weak
spottedweak expression: see section 07 08 09 14 15 16
lung
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18
trachea
weak weak
regionalweak expression: see section 11
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T698
Entity Detected:Cmtm8, CKLF-like MARVEL transmembrane domain containing 8 ( MGI:2447167)
Sequence:sense strand is shown

>T698
TCCTCGAGNCTGTTGGCCTACTGGAGCAGACCCAGAGTGCGCTCGCCGAGGTGTTGGGACACTTGCGGAC
CTGACCCTGGAGATCACCCGGGTTTGCCCGCCTCCCATCATCCGCGATTCCCTGGCCCGCGATCCTGAGC
CCAGGGAACTCATTGGGTGGGGGTAGGGTCCTCGGGGACCCGGGCCAGCTCCTGGGGCGACGATGGAAGA
GCAGCAGCGCGCGCGCTCGCACACGGTCACCACCACTACCAGCTCCTTTGCGGAGAACTTCTCCACCACC
AGCAGCAGCTTCGCTTACGACCGAGAGTTCCTCCGTACCCCGCCGGGGCTCCTGATCGTAGCCGAGATCG
TCTTGGGACTGCTGGTGTGGACTCTCATCGCTGGCACTGAGTATTTTAGAGTCCCTGCTTTTGGCTGGGT
AATGTTTGTGGCTGTCTTCTACTGGGTCCTCACCGTCTTCTTCCTCATTGTCTACATCACCCTGACTTAC
ACCAGGATTCCCCAGGTGCCCTGGACCACAGTGGGCCTGTGCTTTAATGGCAG
Notes:The probe template was PCR amplified from IMAGE:1889204 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1889204 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:19324 same embryo
 EMAGE:19321 same embryo
 EMAGE:19323 same embryo
 EurExpress:euxassay_004903 same experiment
 MGI:4823950 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS