Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:19571

Cetn3 centrin 3 ( MGI:1097706)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:19571 EMAGE:19571 EMAGE:19571 EMAGE:19571 EMAGE:19571
"Pseudo-wholemount" of euxassay_004982. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_004982_01 euxassay_004982_02 euxassay_004982_03 euxassay_004982_04
EMAGE:19571 EMAGE:19571 EMAGE:19571 EMAGE:19571 EMAGE:19571
euxassay_004982_05 euxassay_004982_06 euxassay_004982_07 euxassay_004982_08 euxassay_004982_09
EMAGE:19571 EMAGE:19571 EMAGE:19571 EMAGE:19571 EMAGE:19571
euxassay_004982_10 euxassay_004982_11 euxassay_004982_12 euxassay_004982_13 euxassay_004982_14
EMAGE:19571 EMAGE:19571 EMAGE:19571 EMAGE:19571 EMAGE:19571
euxassay_004982_15 euxassay_004982_16 euxassay_004982_17 euxassay_004982_18 euxassay_004982_19
EMAGE:19571 EMAGE:19571 EMAGE:19571
euxassay_004982_20 euxassay_004982_21 euxassay_004982_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:19571Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
19571_wholemount_strong.wlz
19571_wholemount_moderate.wlz
19571_wholemount_weak.wlz
19571_wholemount_possible.wlz
19571_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:19571_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
vertebral axis musculature
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
thymus primordium
moderate moderate
regionalmoderate expression: see section 08 09 10 11
submandibular gland primordium
strong strong
regionalstrong expression: see section 06 moderate expression: see section 04 05 07 12 13 14
thyroid gland
weak weak
regionalweak expression: see section 08 11
adenohypophysis
moderate moderate
regionalmoderate expression: see section 09 10 11 12
vibrissa
moderate moderate
regionalmoderate expression: see section 03 04 05 06 15 16 17 18
diencephalon lateral wall ventricular layer
moderate moderate
regionalmoderate expression: see section 10 weak expression: see section 11 12
telencephalon mantle layer
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 16 17 18 19 20 21 22
telencephalon ventricular layer
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
4th ventricle
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 08 09 10 11 13 14 15 16 17 18 19 not examined expression: see section 12
midbrain ventricular layer
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 05 not examined expression: see section 06 15
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 14 15 16 17 18 19
not examined not examined
regionalnot examined expression: see section 05
spinal cord ventricular layer
weak weak
regionalweak expression: see section 10 11
cervico-thoracic ganglion
moderate moderate
regionalmoderate expression: see section 07 12
cervical ganglion
moderate moderate
regionalmoderate expression: see section 06 07 13 14
thoracic ganglion
moderate moderate
regionalmoderate expression: see section 09 10 11
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 09 12 13 14 weak expression: see section 06 07 08
inner ear
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 13 14 15 16 17
pharyngo-tympanic tube
moderate moderate
regionalmoderate expression: see section 01 02 19 20 21 22
retina
strong strong
regionalstrong expression: see section 21 moderate expression: see section 01 02 19 20 22
naris
moderate moderate
regionalmoderate expression: see section 08 09 10 12
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13 14 15
nasal cavity respiratory epithelium
moderate moderate
regionalmoderate expression: see section 07 08 09 11 12 13
tongue
moderate moderate
regionalmoderate expression: see section 09 weak expression: see section 10 11
liver
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
metanephros
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 13 14 15 16 not examined expression: see section 17
lung
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19
orbito-sphenoid
moderate moderate
regionalmoderate expression: see section 04 17 18 19 20 21 22 weak expression: see section 01 02 03
clavicle
moderate moderate
regionalmoderate expression: see section 06 07 12 13
tail
moderate moderate
regionalmoderate expression: see section 09 10
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T8032
Entity Detected:Cetn3, centrin 3 ( MGI:1097706)
Sequence:sense strand is shown

>T8032
GACAAGAGGTAATCCGGAGGTTGGTGGCTGTTGAGCGGTTCCCGTGGTAAAGTCCCCGAGTGGAACATCT
CTGTCGGAAGAGAGAATGAGTTTAGCTCTGAGAGGTGAGCTTGTAGTAGACAAAACAAAAAGGAAAAAAC
GAAGAGAGCTCTCTGAAGAACAGAAGCAAGAAATTAAAGATGCTTTTGAGCTGTTTGATACCGACAAAGA
CCAAGCCATAGATTATCATGAATTAAAGGTGGCAATGAGAGCCTTGGGCTTTGATGTGAAAAAGGCTGAT
GTGTTGAAGATTCTTAAAGATTATGACAGAGAAGCCACTGGCAAGATCACATTTGAAGATTTTAATGAAG
TTGTGACAGACTGGATACTAGAGAGAGATCCACATGAGGAGATACTGAAAGCATTTAAACTATTTGACGA
TGACGATTCAGGAAAGATAAGCTTGAGGAATTTACGGCGTGTTGCCAGAGAGCTGGGTGAGAACATGAGC
GATGAGGAGCTCCGGGCCATGATAGAGGAGTTTGACAAAGACGGCGATGGAGAGATAAATCAAGAGGAGT
TCATTGCTATTATGACTGGTGACATATAAAGAATCAACACCAAAATGTTACTTTTACCATCTATCTTCTC
TTTGTGTGCCTGGAGTCCAGTTTAAGAAAACGAAACAAAACAAACGTAGTTCTTTTTCTGAAAGGAACAA
AACCAAGCATCCTTTGTATGTATATTTCAGCATTGTTAAGTTTATGTCATCAATGTAGTAGTTGACTTCA
CATTTATAATACATGTTTATATAAAGTTTTAAAACATCAAATCATGTGGTGTATGTTATTTGGAGTCTTC
TAAATTTAGGACTAGCTAATTGCTTTTATTTTCATGCACATGTTTTTCTTTTGACATTCATTAATAAAAT
ACTTATTTTATTAGTATGTTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Notes:The probe template was PCR amplified from IMAGE:30019209 using vector (pSPORT1) specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T7 polymerase. EMAGE Editor's Note: the probe sequence indicated here was given by the EURExpress Consortium and has been checked using a computational method whereby a BLAST comparison was made against the full insert sequence of IMAGE:30019209 which was retrieved directly from NCBI.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:19568 same embryo
 EMAGE:19567 same embryo
 EMAGE:19570 same embryo
 EMAGE:19569 same embryo
 EMAGE:19572 same embryo
 EurExpress:euxassay_004982 same experiment
 MGI:4823825 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS