Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:19690

BC061237 cDNA sequence BC061237 ( MGI:2682320)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:19690 EMAGE:19690 EMAGE:19690 EMAGE:19690 EMAGE:19690
"Pseudo-wholemount" of euxassay_006341. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_006341_01 euxassay_006341_02 euxassay_006341_03 euxassay_006341_04
EMAGE:19690 EMAGE:19690 EMAGE:19690 EMAGE:19690 EMAGE:19690
euxassay_006341_05 euxassay_006341_06 euxassay_006341_07 euxassay_006341_08 euxassay_006341_09
EMAGE:19690 EMAGE:19690 EMAGE:19690 EMAGE:19690 EMAGE:19690
euxassay_006341_10 euxassay_006341_11 euxassay_006341_12 euxassay_006341_13 euxassay_006341_14
EMAGE:19690 EMAGE:19690 EMAGE:19690 EMAGE:19690 EMAGE:19690
euxassay_006341_15 euxassay_006341_16 euxassay_006341_17 euxassay_006341_18 euxassay_006341_19
EMAGE:19690 EMAGE:19690 EMAGE:19690 EMAGE:19690 EMAGE:19690
euxassay_006341_20 euxassay_006341_21 euxassay_006341_22 euxassay_006341_23 euxassay_006341_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:19690Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
19690_wholemount_strong.wlz
19690_wholemount_moderate.wlz
19690_wholemount_weak.wlz
19690_wholemount_possible.wlz
19690_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:19690_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
hand mesenchyme
moderate moderate
regionalmoderate expression: see section 01 02
foot mesenchyme
moderate moderate
regionalmoderate expression: see section 01 07 21
lower leg mesenchyme
moderate moderate
regionalmoderate expression: see section 01 02 03 04 21
upper leg mesenchyme
moderate moderate
regionalmoderate expression: see section 03 04 21
vertebral axis musculature
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 21 23 24 weak expression: see section 20 22
brain
moderate moderate
regionalmoderate expression: see section 01 02 05 06 07 08 09 10 11 12 13 14 15 16 weak expression: see section 03 04 17 18
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 05 06 weak expression: see section 17
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 05 06 07 08 weak expression: see section 03 04 17 18 19 20 21
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 06 weak expression: see section 17
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 05
trigeminal v nerve
moderate moderate
regionalmoderate expression: see section 09 10 weak expression: see section 17
spinal cord
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13
cervico-thoracic ganglion
moderate moderate
regionalmoderate expression: see section 07 09 weak expression: see section 11 12 13 14
cervical ganglion
moderate moderate
regionalmoderate expression: see section 07 09 weak expression: see section 13 14 15 16
thoracic ganglion
weak weak
regionalweak expression: see section 09 10 11
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 05 06 07 08 12 13 weak expression: see section 14
tongue muscle
moderate moderate
regionalmoderate expression: see section 13 weak expression: see section 11 12 14 15
midgut
strong strong
regionalstrong expression: see section 21 22 23 24 moderate expression: see section 16 17 18 19 weak expression: see section 10 11 12 13 14 15 20
liver
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 12 13 14 15 16 21 22 23 24 weak expression: see section 11 17 18 19 20
bladder
moderate moderate
regionalmoderate expression: see section 13 weak expression: see section 12
lung
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 21 weak expression: see section 17 18 19 20
tail paraxial mesenchyme
moderate moderate
regionalmoderate expression: see section 08 09 10 13 14 16 17 weak expression: see section 11 12 15
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T9699
Entity Detected:BC061237, cDNA sequence BC061237 ( MGI:2682320)
Sequence:sense strand is shown

>T9699
AGTGATGTCACCAGTGTTGTGGTAACAAGAGTTGCCTGTGAGGTATTCCATCAGATCCTAATGGGTTCCC
AAGCAGGGTCATTTAGGAAGGCATCACCCCAAACTCCCAACATCAATGAGAACGAGAAAAGAATCAAGAG
GTTGGAGAAGCTCAAAAGAGATCTCCAGAACATTAAAAATGAGAGAGACGAACTCCAGGGAATCCTGGCC
AAGTACAAGGATTTGAATGACAGGATCAACTTTGAGACATTCATGCTTGAGATGCAACATAACCAGGTGA
TGACTGACCTGAAGAGAATGCCCCAGGACATCAGTGAGGCCTTGTACAAGTACAAGCAGTTGACCACAGA
AAATCAGTTCTACTGCTGCAGGAACTGCCACCTCCTGATTGAATCTAAGCTCATCCAGCACAAAGTCAGG
ATATTGTGGAAGGAGAACAGACAGCTGCTAAGGGAGCAGATTGCATCGGAAGAATGCAACATAAAAACAA
AAATACTATGTAAAGAAGGCAGCCAGAAGATCAAAGACAAATATAGCAGGCAATCAGCAGGAAAACAAAT
AATTGTGGTTCCTGGAAGTAAGGCGGAGGCTGCTATGTCAAATCCATGTGCCTGAGAGTCAAAAAGGCTG
GCTAAGGCTTTGTGTTCCTTCTCTGCACTTGGTGAATAGTGATTGCCCACTGGAAGAGCAACAACAGGAC
CAAAAACAACAACTTAAATAATGGACTTTTTGTGAATCTAAGGGGAATGTCTCTCTTAAAAAGAAAAAAA
ATGTCTTCTTATAATGGAACTGAATATGTCTGCTATGTATTAGTCAGTTTGTTTCACTAGCATTAGAAAG
GTATGAGGAAGAATTTATTAACATCTCATCACCAATAAAAATTAAGGTTTTAAAAGTTAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAA
Notes:The probe template was PCR amplified from IMAGE:6705671 using vector (pDNR-LIB) specific primers. Forward Primer - name:M13 forward (-21), sequence:TGTAAAACGACGGCCAGT; Reverse Primer - name:T3-pDNR-LIB rv, sequence:CAAATTAACCCTCACTAAAGGGTGTTCACTTACCTACTGGGC. Anti-sense probe was then transcribed from the PCR amplified template using T7 polymerase. EMAGE Editor's Note: the probe sequence indicated here was given by the EURExpress Consortium and has been checked using a computational method whereby a BLAST comparison was made against the full insert sequence of IMAGE:6705671 which was retrieved directly from NCBI.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:19687 same embryo
 EMAGE:19688 same embryo
 EMAGE:19689 same embryo
 EMAGE:19691 same embryo
 EurExpress:euxassay_006341 same experiment
 MGI:4823433 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS