Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:19751

Gnl3 guanine nucleotide binding protein-like 3 (nucleolar) ( MGI:1353651)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:19751 EMAGE:19751 EMAGE:19751 EMAGE:19751 EMAGE:19751
"Pseudo-wholemount" of euxassay_006219. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_006219_01 euxassay_006219_02 euxassay_006219_03 euxassay_006219_04
EMAGE:19751 EMAGE:19751 EMAGE:19751 EMAGE:19751 EMAGE:19751
euxassay_006219_05 euxassay_006219_06 euxassay_006219_07 euxassay_006219_08 euxassay_006219_09
EMAGE:19751 EMAGE:19751 EMAGE:19751 EMAGE:19751 EMAGE:19751
euxassay_006219_10 euxassay_006219_11 euxassay_006219_12 euxassay_006219_13 euxassay_006219_14
EMAGE:19751 EMAGE:19751 EMAGE:19751 EMAGE:19751 EMAGE:19751
euxassay_006219_15 euxassay_006219_16 euxassay_006219_17 euxassay_006219_18 euxassay_006219_19
EMAGE:19751 EMAGE:19751 EMAGE:19751 EMAGE:19751 EMAGE:19751
euxassay_006219_20 euxassay_006219_21 euxassay_006219_22 euxassay_006219_23 euxassay_006219_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:19751Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
19751_wholemount_strong.wlz
19751_wholemount_moderate.wlz
19751_wholemount_weak.wlz
19751_wholemount_possible.wlz
19751_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:19751_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
vertebral axis musculature
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
thymus primordium
moderate moderate
homogeneousmoderate expression: see section 10 11 12 13 14
submandibular gland primordium
strong strong
regionalstrong expression: see section 06 07 08 15 16 17 18
vibrissa
strong strong
regionalstrong expression: see section 05 06 07 20 21 moderate expression: see section 19
diencephalon lateral wall ventricular layer
moderate moderate
regionalmoderate expression: see section 14 15
olfactory cortex ventricular layer
strong strong
homogeneousstrong expression: see section 11 17
telencephalon ventricular layer
strong strong
homogeneousstrong expression: see section 03 04 05 06 07 08 09 10 11 12 13 17 18 19 20 21 22 23 moderate expression: see section 14 16 24
metencephalon rest of alar plate marginal layer
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 12 16 17 18 19 20 21 22
metencephalon rest of alar plate ventricular layer
moderate moderate
regionalmoderate expression: see section 05 06 21 22
midbrain ventricular layer
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15 16 17 18
neural retina
weak weak
regionalweak expression: see section 01 02 03 04 22 23 24
midgut
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13 14
mandible
strong strong
regionalstrong expression: see section 03 04 05 17 21 22 moderate expression: see section 06 07 08 09 10 13 14 15 16 18 19 20
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 10 13 14
lower jaw molar
strong strong
regionalstrong expression: see section 17 moderate expression: see section 07 08 18 19 20
maxilla
strong strong
regionalstrong expression: see section 05 moderate expression: see section 06 07 08 10 18
palatal shelf
moderate moderate
regionalmoderate expression: see section 09
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 10 11 14 15
upper jaw molar
strong strong
regionalstrong expression: see section 17 moderate expression: see section 07 08 18 19 20
liver left lobe
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14
liver right lobe
moderate moderate
regionalmoderate expression: see section 15 16 17 18 19 20 21 22 23 24
renal cortex
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 16 17 18 19 20
testis
moderate moderate
regionalmoderate expression: see section 06 07 weak expression: see section 18 19 20
left lung
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 11 12
right lung
moderate moderate
regionalmoderate expression: see section 13 14 15 16 17 18 19 20 21
orbito-sphenoid
strong strong
regionalstrong expression: see section 04 05 06 21 moderate expression: see section 01 02 03 22 23 24 weak expression: see section 07 20
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T709
Entity Detected:Gnl3, guanine nucleotide binding protein-like 3 (nucleolar) ( MGI:1353651)
Sequence:sense strand is shown

>T709
GTTGGCCTACTGGGAGTTCGCACGTGGCGCCCGAGAAGTCGTGGTGATCCCGAGACCTCCTCTGCTCCTG
AAGCGTCCGCGGCCAGGATGAAGAGGCCTAAGTTAAAGAAAGCGAGTAAACGTATGACCTGCCATAAGCG
ATATAAAATTCAAAAAAAGGTCCGAGAACATCATCGAAAATTAAGGAAGGAAGCTAAAAAACGGGGTCAC
AAGAAGCCTAGGAAGGACCCAGGTGTTCCAAATAGTGCTCCCTTTAAAGAGGCTCTTCTTCGTGAAGCTG
AACTAAGGAAACAGCAGCTTGAAGAACTAAAACAGCAGCAGAAACTTGATAGGCAAAAAGAGCAAGAAAG
GAAAAGAAAACTTGAAGTTAGCCCTGGTGATGAGCAGTCTAATGTGGAAACTAGGGAGGAATCTGACGAG
CCCAAAAGAAAGAAAGCCAAAGCAGGCAAACAGAATCCAAAGAAGTTACATTGCCAGGAACTTAAAAAGG
TGATTGAAGCCTCAGACATTGTGTTAGAAGTTTTGGATGCCAGAGATC
Notes:The probe template was PCR amplified from IMAGE:1889603 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1889603 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:19749 same embryo
 EMAGE:19753 same embryo
 EMAGE:19750 same embryo
 EMAGE:19752 same embryo
 EurExpress:euxassay_006219 same experiment
 MGI:4825144 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS