Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:19797

Gabrd gamma-aminobutyric acid (GABA) A receptor, subunit delta ( MGI:95622)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:19797 EMAGE:19797 EMAGE:19797 EMAGE:19797 EMAGE:19797
"Pseudo-wholemount" of euxassay_006314. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_006314_01 euxassay_006314_02 euxassay_006314_03 euxassay_006314_04
EMAGE:19797 EMAGE:19797 EMAGE:19797 EMAGE:19797 EMAGE:19797
euxassay_006314_05 euxassay_006314_06 euxassay_006314_07 euxassay_006314_08 euxassay_006314_09
EMAGE:19797 EMAGE:19797 EMAGE:19797 EMAGE:19797 EMAGE:19797
euxassay_006314_10 euxassay_006314_11 euxassay_006314_12 euxassay_006314_13 euxassay_006314_14
EMAGE:19797 EMAGE:19797 EMAGE:19797 EMAGE:19797 EMAGE:19797
euxassay_006314_15 euxassay_006314_16 euxassay_006314_17 euxassay_006314_18 euxassay_006314_19
EMAGE:19797 EMAGE:19797 EMAGE:19797 EMAGE:19797
euxassay_006314_20 euxassay_006314_21 euxassay_006314_22 euxassay_006314_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:19797Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
19797_wholemount_strong.wlz
19797_wholemount_moderate.wlz
19797_wholemount_weak.wlz
19797_wholemount_possible.wlz
19797_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:19797_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
vertebral axis musculature
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
thymus primordium
strong strong
regionalstrong expression: see section 09 10 11 moderate expression: see section 12
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 05 06 07 08 15 16 17
vibrissa
moderate moderate
regionalmoderate expression: see section 04 05 06 07 19 20 21 22
diencephalon lateral wall ventricular layer
strong strong
regionalstrong expression: see section 10 13 14 moderate expression: see section 11 12
telencephalon ventricular layer
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
medulla oblongata basal plate ventricular layer
strong strong
regionalstrong expression: see section 13 moderate expression: see section 05 06 07 08 09 10 11 12
rest of cerebellum marginal layer
strong strong
regionalstrong expression: see section 02 03 13 14 15 16 17 18 19 moderate expression: see section 04 05 06 07 08 09 10 11 12
rest of cerebellum ventricular layer
strong strong
regionalstrong expression: see section 02 03 13 14 15 16 17 18 19 20 moderate expression: see section 04 05 06 07 08 09 10 11 12
pons ventricular layer
strong strong
regionalstrong expression: see section 03 13 14 15 16 17 18 19 moderate expression: see section 04 05 06 07 08 09 10 11 12
midbrain ventricular layer
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 13 14 15 16
spinal cord ventricular layer
strong strong
regionalstrong expression: see section 11 12 moderate expression: see section 10
not examined not examined
regionalnot examined expression: see section 01 02 03 21 22 23
neural retina
moderate moderate
regionalmoderate expression: see section 01 02 03 21 22 23
naris
moderate moderate
regionalmoderate expression: see section 13 14 15 16
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 14 15 16 17 18
liver
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
metanephros
moderate moderate
regionalmoderate expression: see section 04 13 18
renal cortex
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 14 15 16 17
larynx
moderate moderate
regionalmoderate expression: see section 07
lung
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 08 09 10 11 12 13 14 15 16 17 18 19 20 21
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T35012
Entity Detected:Gabrd, gamma-aminobutyric acid (GABA) A receptor, subunit delta ( MGI:95622)
Sequence:sense strand is shown

>T35012
ACAACCATACCAACGAGACCTTAGGCCTGGACAGCCGCTTTGTGGACAAGCTATGGCTCCCTGACACCTT
CATCGTGAATGCCAAATCTGCCTGGTTCCATGATGTGACTGTGGAAAACAAGCTTATCCGCCTACAGCCT
GATGGGGTGATTTTATACAGCATCCGCATCACCTCCACAGTGGCCTGTGACATGGACCTCGCCAAGTACC
CACTGGATGAGCAGGAGTGCATGCTGGACCTAGAGAGCTATGGCTACTCTTCTGAGGACATTGTCTATTA
TTGGTCAGAAAACCAGGAGCAGATCCATGGGCTGGACAGGCTGCAGCTGGCCCAGTTCACTATCACCAGT
TACCGCTTCACCACGGAGCTGATGAACTTCAAATCGGCTGGCCAGTTCCCACGGCTCAGCTTACACTTCC
AGCTTCGGAGGAACCGGGGCGTCTACATCATCCAGTCTCACATGCCCTCTGTCCTCCTGGTTGCCATGTC
CTGGGTCTCCTTCTGGATTAGCCAGGCAGCCGTGCCTGCCAGAGTATCTCTAGGCATCACCACTGTGCTG
ACAATGACCACGCTCATGGTCAGTGCCCGCTCCTCCCTGCCACGGGCTTCAGCTATCAAAGCTCTGGATG
TGTATTTTTGGATCTGCTACGTCTTTGTGTTTGCTGCCCTGGTGGAGTATGCATTTGCCCACTTCAATGC
CGACTACAGGAAGAAACGGAAAGCCAAGGTCAAGGTCACCAAGCCAAGGGCAGAGATGGATGTGAGGAAC
GCCATCGTCCTTTTCTCCCTCTCAGCTGCTG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 50120. Forward Primer - name:050120_F_cDNA_Gabrd, sequence:ACAACCATACCAACGAGACCTT; Reverse Primer - name:050120_N_SP6_cDNA_Gabrd, sequence:CAGCAGCTGAGAGGGAGAAAA. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:19799 same embryo
 EMAGE:19798 same embryo
 EMAGE:19796 same embryo
 EurExpress:euxassay_006314 same experiment
 MGI:4824966 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS