Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:19825

2610109H07Rik RIKEN cDNA 2610109H07 gene ( MGI:1917683)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:19825 EMAGE:19825 EMAGE:19825 EMAGE:19825 EMAGE:19825
"Pseudo-wholemount" of euxassay_006367. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_006367_01 euxassay_006367_02 euxassay_006367_03 euxassay_006367_04
EMAGE:19825 EMAGE:19825 EMAGE:19825 EMAGE:19825 EMAGE:19825
euxassay_006367_05 euxassay_006367_06 euxassay_006367_07 euxassay_006367_08 euxassay_006367_09
EMAGE:19825 EMAGE:19825 EMAGE:19825 EMAGE:19825 EMAGE:19825
euxassay_006367_10 euxassay_006367_11 euxassay_006367_12 euxassay_006367_13 euxassay_006367_14
EMAGE:19825 EMAGE:19825 EMAGE:19825 EMAGE:19825 EMAGE:19825
euxassay_006367_15 euxassay_006367_16 euxassay_006367_17 euxassay_006367_18 euxassay_006367_19
EMAGE:19825 EMAGE:19825 EMAGE:19825 EMAGE:19825
euxassay_006367_20 euxassay_006367_21 euxassay_006367_22 euxassay_006367_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:19825Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
19825_wholemount_strong.wlz
19825_wholemount_moderate.wlz
19825_wholemount_weak.wlz
19825_wholemount_possible.wlz
19825_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:19825_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
vibrissa
moderate moderate
regionalmoderate expression: see section 07 20 21 weak expression: see section 08 09
diencephalon lateral wall
strong strong
regionalstrong expression: see section 10 11 12 moderate expression: see section 06 07 08 09 13 14 15 16 17
cerebral cortex
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 moderate expression: see section 21 22 23
cerebral cortex mantle layer
moderate moderate
regionalmoderate expression: see section 01 02
cerebral cortex marginal layer
moderate moderate
regionalmoderate expression: see section 01 02
telencephalon mantle layer
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
olfactory cortex mantle layer
moderate moderate
regionalmoderate expression: see section 10 11 14 15 16 17
olfactory cortex marginal layer
moderate moderate
regionalmoderate expression: see section 10 11 14 15 16 17
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18
medulla oblongata basal plate ventricular layer
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19
rest of cerebellum mantle layer
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19
rest of cerebellum marginal layer
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
pons
strong strong
regionalstrong expression: see section 03
pons mantle layer
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18
pons ventricular layer
strong strong
regionalstrong expression: see section 04
midbrain meninges
moderate moderate
regionalmoderate expression: see section 17
midbrain lateral wall
strong strong
regionalstrong expression: see section 10 11 12 moderate expression: see section 04 05 06 07 08 09 13 14 15 16
glossopharyngeal ix ganglion
weak weak
homogeneousweak expression: see section 06 16
trigeminal v ganglion
moderate moderate
homogeneousmoderate expression: see section 17 18 weak expression: see section 03 04 05 06 07 08 16 19 20 21
vestibulocochlear viii ganglion
moderate moderate
homogeneousmoderate expression: see section 17 weak expression: see section 06
spinal cord lateral wall
strong strong
regionalstrong expression: see section 10 moderate expression: see section 07 08 09 11 12
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 07 08 09 weak expression: see section 06 11 12 13 15
neural retina
moderate moderate
regionalmoderate expression: see section 04 22 23 weak expression: see section 01 02 03
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T35073
Entity Detected:2610109H07Rik, RIKEN cDNA 2610109H07 gene ( MGI:1917683)
Sequence:sense strand is shown

>T35073
CAGGGAGGTTTAGGACAAACAGGACCGTGTTAGTAACTAGCTCAGCTTGGGCTGAGTAGGGAACCAATGG
CTGAGGCAGCAGGTGTACGCCCAGTACACTCAACCACAAGCTGGAGAGCGGTTTAGCAGAGAGCAGTGCG
CCAGAGCCCGCCCGCCCGCAGTCCGGGGTGGGACCCCCACCTGCTCCCTGATTCTGCTCGACTCGGCGGT
GGCTTTGTGTAGCGCACCCTCTTCTGCTCGACACCAGCATTGCAGCAGTTTCAATTGGCGAAAACAAGAG
GCTTCCTTGACTGAAAAGGGTTGGAAAGAGAGGGGACAACTGACAGTCCTGGATCTGGAATGCTATGTCG
CAGGCAAACGCCAAGCGCCACATGTATTTTTACTGAATTTCCACAGAGACCGTGGTAAGAGACCACTGAC
CCGCACCTGAGGTGCGCGATCCCACGTTCAGAGTCCCACGTCATCCATGATCCTCCAGTTTTGGCCACAG
AGACTAGACTTGACCTGTTCTCAGGCTTTTCCCAAGAGAGACTTATGTCTTTTTTGATGGACTGAGTCTC
ACTCTTTGGCCAAGCTGGCAACTCAGACAATCCTCCTGCCTCAGTCTTCCAAATGCTGGAATTATAGGCA
TGGGTCAGCATATTTGGCAGGTGTATCTTCCTTAAAAACAAGACATTAGGGCTGGGGATGTGGCTACGTT
TGTAACATGCTTGCCTGGAATGCATGAATCCTGCCCAGGCTGGACTTCTTCTGATTAGTGAGTGTGAGGC
CAGACCACAGCAGACTGCATCTCAAGCAAAACAAAGTAAGCTGTTTGCCTCACCTGC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 78383. Forward Primer - name:078383_F_cDNA_2610109H07Rik, sequence:CAGGGAGGTTTAGGACAAACAG; Reverse Primer - name:078383_N_SP6_cDNA_2610109H07Rik, sequence:GCAGGTGAGGCAAACAGCTTA. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:19827 same embryo
 EMAGE:19824 same embryo
 EMAGE:19826 same embryo
 EMAGE:19823 same embryo
 EMAGE:19828 same embryo
 EurExpress:euxassay_006367 same experiment
 MGI:4822681 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS