Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:19887

Plekha7 pleckstrin homology domain containing, family A member 7 ( MGI:2445094)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:19887 EMAGE:19887 EMAGE:19887 EMAGE:19887 EMAGE:19887
"Pseudo-wholemount" of euxassay_009322. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_009322_01 euxassay_009322_02 euxassay_009322_03 euxassay_009322_04
EMAGE:19887 EMAGE:19887 EMAGE:19887 EMAGE:19887 EMAGE:19887
euxassay_009322_05 euxassay_009322_06 euxassay_009322_07 euxassay_009322_08 euxassay_009322_09
EMAGE:19887 EMAGE:19887 EMAGE:19887 EMAGE:19887 EMAGE:19887
euxassay_009322_10 euxassay_009322_11 euxassay_009322_12 euxassay_009322_13 euxassay_009322_14
EMAGE:19887 EMAGE:19887 EMAGE:19887 EMAGE:19887 EMAGE:19887
euxassay_009322_15 euxassay_009322_16 euxassay_009322_17 euxassay_009322_18 euxassay_009322_19
EMAGE:19887 EMAGE:19887 EMAGE:19887 EMAGE:19887 EMAGE:19887
euxassay_009322_20 euxassay_009322_21 euxassay_009322_22 euxassay_009322_23 euxassay_009322_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:19887Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
19887_wholemount_strong.wlz
19887_wholemount_moderate.wlz
19887_wholemount_weak.wlz
19887_wholemount_possible.wlz
19887_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:19887_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
diaphragm
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07 09 10 11 12 13 14 15 16 17 22 23 24
vertebral axis musculature
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
thymus primordium
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 07 08 09 10 17 18 19
diencephalon lateral wall ventricular layer
moderate moderate
regionalmoderate expression: see section 13 14 15 16
telencephalon ventricular layer
moderate moderate
regionalmoderate expression: see section 13 14 15 16 17 18 19 20 21
medulla oblongata alar plate ventricular layer
moderate moderate
regionalmoderate expression: see section 13 14 15
medulla oblongata basal plate ventricular layer
moderate moderate
regionalmoderate expression: see section 13
rest of cerebellum ventricular layer
moderate moderate
regionalmoderate expression: see section 13 14 15
pons ventricular layer
moderate moderate
regionalmoderate expression: see section 13 14 15
midbrain ventricular layer
moderate moderate
regionalmoderate expression: see section 13 14 15 16
pharyngo-tympanic tube
moderate moderate
regionalmoderate expression: see section 01 02 03 04 22 23 24
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 10 11 13 14 16 17 18 19 20
nasal cavity respiratory epithelium
moderate moderate
regionalmoderate expression: see section 12 13 14 16 17 18
heart atrium
moderate moderate
regionalmoderate expression: see section 10 15 16 17 18
heart ventricle
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 15 16
tongue muscle
moderate moderate
regionalmoderate expression: see section 12 13 14 15 16 17
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 11 12
lower jaw molar
moderate moderate
regionalmoderate expression: see section 07 08 20 21
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 12
upper jaw molar
moderate moderate
regionalmoderate expression: see section 07 08 20 21
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T35816
Entity Detected:Plekha7, pleckstrin homology domain containing, family A member 7 ( MGI:2445094)
Sequence:sense strand is shown

>T35816
AGTGATGTCTCCTCTGCAGTCACCAACCAAGGCAAAGCCTCAGGCGGAAGACGAGGCACCTCCCAGGCCA
CCACTTCCTGAACTCTACAGCCCAGAGGACCAGCCCCCAGCTGTGCCACCACTGCCGAGAGAAGCCACCA
TCATTCGGCACACATCTGTGCGTGGACTCAAACGACAGTCGGATGAGAGGAAGAGGGACCGGGAGCAGGG
CCAGTGTGTGAATGGGGACTTGAAGGTGGAGCTCCGGTCCTACGTGAGTGAGCCAGAGCTGGCCAGCCTC
AGTGGGGACGTGCCTCAGCCCTCCTTGAGCCTCGTGGGCTCTGAGAGCAGGTACCAGACGCTGCCAGGCA
GAGGGCTCTCAGGCTCCACGTCCAGGCTCCAGCAGTCGTCCACCATTGCTCCCTATGTCACACTCCGGAG
GGGGCTGAATGCCGAAAACAGCAGTGCGACCTTCTCTAGACCCAAGAGTGCCTTGGAGCGTCTGTACTCG
GGGGACCACCAGCGGGGCAAGATGAGTGCGGAGGAACAGCTGGAGCGGATGAAGCGGCACCAGAAGGCTC
TGGTCCGAGAGCGCAAGAGGACCCTGAGCCAAGGAGAAAAGACGGGTCTGCTC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 88946. Forward Primer - name:088946_F_cDNA_A430081P20Rik, sequence:AGTGATGTCTCCTCTGCAGTCA; Reverse Primer - name:088946_N_SP6_cDNA_A430081P20Rik, sequence:GAGCAGACCCGTCTTTTCTCC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:19889 same embryo
 EMAGE:19886 same embryo
 EMAGE:19888 same embryo
 EMAGE:19885 same embryo
 EMAGE:19884 same embryo
 EurExpress:euxassay_009322 same experiment
 MGI:4827268 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS