Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:19904

Plch2 phospholipase C, eta 2 ( MGI:2443078)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:19904 EMAGE:19904 EMAGE:19904 EMAGE:19904 EMAGE:19904
"Pseudo-wholemount" of euxassay_009414. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_009414_01 euxassay_009414_02 euxassay_009414_03 euxassay_009414_04
EMAGE:19904 EMAGE:19904 EMAGE:19904 EMAGE:19904 EMAGE:19904
euxassay_009414_05 euxassay_009414_06 euxassay_009414_07 euxassay_009414_08 euxassay_009414_09
EMAGE:19904 EMAGE:19904 EMAGE:19904 EMAGE:19904 EMAGE:19904
euxassay_009414_10 euxassay_009414_11 euxassay_009414_12 euxassay_009414_13 euxassay_009414_14
EMAGE:19904 EMAGE:19904 EMAGE:19904 EMAGE:19904 EMAGE:19904
euxassay_009414_15 euxassay_009414_16 euxassay_009414_17 euxassay_009414_18 euxassay_009414_19
EMAGE:19904 EMAGE:19904 EMAGE:19904 EMAGE:19904 EMAGE:19904
euxassay_009414_20 euxassay_009414_21 euxassay_009414_22 euxassay_009414_23 euxassay_009414_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:19904Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
19904_wholemount_strong.wlz
19904_wholemount_moderate.wlz
19904_wholemount_weak.wlz
19904_wholemount_possible.wlz
19904_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:19904_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
submandibular gland primordium
weak weak
regionalweak expression: see section 06 07 08 09 16 17 18 19
vibrissa
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 22 23 24 weak expression: see section 21
telencephalon marginal layer
moderate moderate
regionalmoderate expression: see section 04 05 06 07 16 17 19 20 weak expression: see section 18
medulla oblongata basal plate mantle layer
moderate moderate
single cellmoderate expression: see section 06 07 09 10 11 12 14 15 16 weak expression: see section 13
pons mantle layer
moderate moderate
regionalmoderate expression: see section 06 07 14 15 16 17
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 05 06 07 16 17 18
dorsal grey horn
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 12 13 14
naris
weak weak
regionalweak expression: see section 13 14 15 16 17 18
nasal cavity olfactory epithelium
weak weak
regionalweak expression: see section 09 10 11 12 16 17 18 19 20
lower jaw incisor
weak weak
regionalweak expression: see section 11 12 13 16 17
lower jaw molar
weak weak
regionalweak expression: see section 08 19
upper jaw incisor
weak weak
regionalweak expression: see section 12 13 14 15 16 17
upper jaw molar
weak weak
regionalweak expression: see section 07 08 19 20
bladder
weak weak
regionalExpression in the fundus region.
urethra of male
weak weak
regionalweak expression: see section 12 13
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T35849
Entity Detected:Plch2, phospholipase C, eta 2 ( MGI:2443078)
Sequence:sense strand is shown

>T35849
CTGGAGGAGATCAGGAGTCATTCCCCCATGTTCTCCACCGTTAGGGATTGAGACCTGCGAGTGCCAGATA
CTCGCCTCTTCCCCCTGCAGCGGCCCATCTCCCCCCTGTGCAGCCTGGAACCCATTGCCGAGGAACCAGC
CCTGGGCCCTGGCCTCCCGTTACAGGCAGCTGCCCCCACAGGTCCATCTCAGGAAGGGTCCCAGTGCCCT
GTAGGCCTGGGAGCCAAAGTGACCAGCTCCCAGCAGACATCTCTGGGAGCTTTTGGAACCCTCCAGCTCA
GGATTGGGGGCGGTAGGGAAAACGAAGAGCCACCCCTCAGGCCACACAATGGTGGGATCTCCAGCGGGCC
ACGTGAGGGGACTTCTGGAAGACAGACAGACAGCAAGAGCCGCTCCCGGGTCCCGGGCCACTTGCCAGTG
GTTAGGAGGGCCAAGAGTGAGGGCCAGGTACTCTCGGAGCTCTCTCCCACACCTGCAGTGTACTCGGATG
CCACGGGCACTGACAGGTTATGGCAGCGGCTGGAGCCTGGGAGCCACAGGGACAGTGTCTCCTCATCCTC
CAGCATGTCCTCCAACGACACCGTCATAGACCTATCACTGCCCAGCCTCGGCCTCTGCCGCAGCCGAGAG
AGCATTGCAGGGGCTCTCTCTTGGACGCCTAACCTCACGGCCCTGCTTAGCCTCAGCTGCCCGTCCTGAC
CTGCCTCCTGTGACCAAGAGCAAATCGAACCCCAACCTGCGGGTTGCGGGTGGGCTGCCTACTGCACCCG
ACGAGCTGCAGCCCCGGCCTCTTGCCCCGCGGCTGACCGGCCACCATCCACGGCCACCGTGGCATCACCT
CACCCTGGTGGGCCTGCGGGACTGCCCAGTGTCTGCTAA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 89336. Forward Primer - name:089336_F_cDNA_A930027K05Rik, sequence:CTGGAGGAGATCAGGAGTCATT; Reverse Primer - name:089336_N_SP6_cDNA_A930027K05Rik, sequence:TTAGCAGACACTGGGCAGTCC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:19901 same embryo
 EMAGE:19902 same embryo
 EMAGE:19903 same embryo
 EMAGE:19900 same embryo
 EurExpress:euxassay_009414 same experiment
 MGI:4827256 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS