Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:19935

Myh14 myosin, heavy polypeptide 14 ( MGI:1919210)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:19935 EMAGE:19935 EMAGE:19935 EMAGE:19935 EMAGE:19935
"Pseudo-wholemount" of euxassay_009370. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_009370_01 euxassay_009370_02 euxassay_009370_03 euxassay_009370_04
EMAGE:19935 EMAGE:19935 EMAGE:19935 EMAGE:19935 EMAGE:19935
euxassay_009370_05 euxassay_009370_06 euxassay_009370_07 euxassay_009370_08 euxassay_009370_09
EMAGE:19935 EMAGE:19935 EMAGE:19935 EMAGE:19935 EMAGE:19935
euxassay_009370_10 euxassay_009370_11 euxassay_009370_12 euxassay_009370_13 euxassay_009370_14
EMAGE:19935 EMAGE:19935 EMAGE:19935 EMAGE:19935 EMAGE:19935
euxassay_009370_15 euxassay_009370_16 euxassay_009370_17 euxassay_009370_18 euxassay_009370_19
EMAGE:19935 EMAGE:19935 EMAGE:19935
euxassay_009370_20 euxassay_009370_21 euxassay_009370_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:19935Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
19935_wholemount_strong.wlz
19935_wholemount_moderate.wlz
19935_wholemount_weak.wlz
19935_wholemount_possible.wlz
19935_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:19935_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
vibrissa
moderate moderate
regionalmoderate expression: see section 04 05 06 19 20
cochlea
moderate moderate
regionalmoderate expression: see section 04 05 06 07 15 16 17
utricle
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 16 17 18 19
anterior naris epithelium
strong strong
regionalstrong expression: see section 11 12 13 14
external naris epithelium
strong strong
regionalstrong expression: see section 10 15
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 07 08 09 10 11 13 14 15 16 17
pharynx epithelium
strong strong
regionalstrong expression: see section 10 11
stomach
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06
rectum
moderate moderate
regionalmoderate expression: see section 09
midgut
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 15 16 17
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 14 weak expression: see section 11
lower jaw molar
moderate moderate
regionalmoderate expression: see section 05 weak expression: see section 17
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 14 weak expression: see section 11
upper jaw molar
moderate moderate
regionalmoderate expression: see section 05 18 weak expression: see section 17
larynx
strong strong
regionalstrong expression: see section 10 11
left lung
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08
right lung
moderate moderate
regionalmoderate expression: see section 09 13 15 16 17 18 19 weak expression: see section 10 12 14 20
trachea
strong strong
regionalstrong expression: see section 10 11 12
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36655
Entity Detected:Myh14, myosin, heavy polypeptide 14 ( MGI:1919210)
Sequence:sense strand is shown

>T36655
AGAGGAGAAGGCTGCAGTTCTACGGGCTGTGGAAGACCGTGAACGGATAGAGGCCGAAGGCCGGGAGCGA
GAGGCCCGGGCCCTGTCGCTGACCCGGGCCCTGGAAGAGGAGCAGGAGGCCCGGGAGGAGCTGGAGAGGC
AGAACCGTGCTCTGAGGGCTGAGCTGGAAGCACTGCTGAGCAGCAAGGATGACGTGGGCAAGAACGTGCA
CGAGCTGGAGCGAGCCCGTAAGGCGGCTGAACAGGCAGCCAGTGACCTGCGGACACAGGTGACAGAATTG
GAGGATGAGCTGACAGCCGCAGAGGATGCCAAGCTGCGCCTGGAGGTGACTGTGCAGGCTCTGAAGGCTC
AACATGAACGCGACCTGCAGGGCCGCGATGATGCCGGTGAGGAGAGGCGGAGGCAGCTGGCCAAGCAGCT
AAGAGACGCAGAGGTAGAGCGCGATGAGGAACGGAAGCAGAGGGCACTGGCTATGGCTGCCCGCAAGAAG
CTGGAGCTGGAACTGGAGGAGTTGAAGGCGCAGACATCTGCTGCTGGGCAGGGCAAGGAAGAGGCAGTGA
AGCAGCTGAAGAAGATGCAGGTCCAGATGAAGGAGCTGTGGCGGGAGGTAGAGGAGACGCGTAGCTCC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 91441. Forward Primer - name:091441_F_cDNA_Myh14, sequence:AGAGGAGAAGGCTGCAGTTCTA; Reverse Primer - name:091441_N_SP6_cDNA_Myh14, sequence:GGAGCTACGCGTCTCCTCTAC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:19933 same embryo
 EMAGE:19936 same embryo
 EMAGE:19937 same embryo
 EMAGE:19938 same embryo
 EMAGE:19934 same embryo
 EurExpress:euxassay_009370 same experiment
 MGI:4826541 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS