Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:19941

Etfa electron transferring flavoprotein, alpha polypeptide ( MGI:106092)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:19941 EMAGE:19941 EMAGE:19941 EMAGE:19941 EMAGE:19941
"Pseudo-wholemount" of euxassay_002051. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_002051_01 euxassay_002051_02 euxassay_002051_03 euxassay_002051_04
EMAGE:19941 EMAGE:19941 EMAGE:19941 EMAGE:19941 EMAGE:19941
euxassay_002051_05 euxassay_002051_06 euxassay_002051_07 euxassay_002051_08 euxassay_002051_09
EMAGE:19941 EMAGE:19941 EMAGE:19941 EMAGE:19941 EMAGE:19941
euxassay_002051_10 euxassay_002051_11 euxassay_002051_12 euxassay_002051_13 euxassay_002051_14
EMAGE:19941 EMAGE:19941 EMAGE:19941 EMAGE:19941 EMAGE:19941
euxassay_002051_15 euxassay_002051_16 euxassay_002051_17 euxassay_002051_18 euxassay_002051_19
EMAGE:19941 EMAGE:19941 EMAGE:19941 EMAGE:19941 EMAGE:19941
euxassay_002051_20 euxassay_002051_21 euxassay_002051_22 euxassay_002051_23 euxassay_002051_24
EMAGE:19941 EMAGE:19941 EMAGE:19941 EMAGE:19941
euxassay_002051_25 euxassay_002051_26 euxassay_002051_27 euxassay_002051_28

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:19941Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
19941_wholemount_strong.wlz
19941_wholemount_moderate.wlz
19941_wholemount_weak.wlz
19941_wholemount_possible.wlz
19941_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:19941_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
thymus primordium
strong strong
homogeneousstrong expression: see section 12 13 14 15 16 17 18
olfactory cortex ventricular layer
strong strong
homogeneousstrong expression: see section 11 12 13 17 18 19
telencephalon ventricular layer
strong strong
homogeneousstrong expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1139
Entity Detected:Etfa, electron transferring flavoprotein, alpha polypeptide ( MGI:106092)
Sequence:sense strand is shown

>T1139
CCTCGAGNCTGTTGGCCTACTGGATCTCGCGAGCGTTCGGGTCTCTGGTAGAGGAGGCGGCGGCGGTGGC
GGCGGCGGTGGTTCCCGCGCGCTCCGGGTCTCTGAGGCTGAGGGTACTGCGGGGCTGACTAGAACAGAGA
CAATGTTTCGAGCAGCGGACGCCTGGGCAGCTCCGGCGGGCGGCCTCATTGCTCCGTTTTCAGAGTACCT
TGGTAATAGCTGAGCATGCAAATGATTCCCTAGCACCCATTACTCTAAATACTATCACTGCAGCTGGACG
TCTTGGAGGTGAAGTGTCCTGCTTAGTAGCTGGAACCAAGTGTGACAAGGTGGTACAGGATCTATGTAAA
GTAGCTGGCGTAGCAAAGGTTCTGGTGGCTCAGCATGATGCATACAAAGGCCTTCTTCCAGAGGAACTCA
CACCATTGATTTTGGAAACTCAGAAGCAGTTCAGTTACACACATCTGTGCTGGAGCGTCTGCTTTTGGAA
AGAACCTTCTGCCCAGAGTAGCTGCCGAACTTAATGTTGCTCCAGTTTCTGACATCATTGAGATCAAGTC
ACCTGACACATTTGTGAGAACTATCTAT
Notes:The probe template was PCR amplified from IMAGE:2135897 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:2135897 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:MGI:4824629 same experiment
 EurExpress:euxassay_002051 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS