Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:19964

Mtss1l metastasis suppressor 1-like ( MGI:3039591)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:19964 EMAGE:19964 EMAGE:19964 EMAGE:19964 EMAGE:19964
"Pseudo-wholemount" of euxassay_009417. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_009417_01 euxassay_009417_02 euxassay_009417_03 euxassay_009417_04
EMAGE:19964 EMAGE:19964 EMAGE:19964 EMAGE:19964 EMAGE:19964
euxassay_009417_05 euxassay_009417_06 euxassay_009417_07 euxassay_009417_08 euxassay_009417_09
EMAGE:19964 EMAGE:19964 EMAGE:19964 EMAGE:19964 EMAGE:19964
euxassay_009417_10 euxassay_009417_11 euxassay_009417_12 euxassay_009417_13 euxassay_009417_14
EMAGE:19964 EMAGE:19964 EMAGE:19964 EMAGE:19964
euxassay_009417_15 euxassay_009417_16 euxassay_009417_17 euxassay_009417_18

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:19964Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
19964_wholemount_strong.wlz
19964_wholemount_moderate.wlz
19964_wholemount_weak.wlz
19964_wholemount_possible.wlz
19964_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:19964_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
cervical intervertebral disc
weak weak
regionalweak expression: see section 08
lumbar intervertebral disc
weak weak
regionalweak expression: see section 07 08
thoracic intervertebral disc
weak weak
regionalweak expression: see section 07 08
hindlimb digit 1 metatarsal
weak weak
regionalweak expression: see section 03 04 17
hindlimb digit 2 metatarsal
weak weak
regionalweak expression: see section 03 04 17
hindlimb digit 3 metatarsal
weak weak
regionalweak expression: see section 03 04 17
hindlimb digit 4 metatarsal
weak weak
regionalweak expression: see section 03
hindlimb digit 5 metatarsal
weak weak
regionalweak expression: see section 03
vertebral axis musculature
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18
vibrissa
weak weak
regionalweak expression: see section 04 05 06 16 17 18
diencephalon meninges
weak weak
regionalweak expression: see section 06 07 08 09 10 11 12 13 14
telencephalon meninges
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18
hindbrain meninges
weak weak
regionalweak expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15
midbrain meninges
weak weak
regionalweak expression: see section 04 05 06 07 08 09 10 11 12 14
midbrain lateral wall
weak weak
regionalweak expression: see section 13
facial vii ganglion
weak weak
regionalweak expression: see section 03 15
glossopharyngeal ix ganglion
weak weak
regionalweak expression: see section 04 05 12 13
trigeminal v ganglion
weak weak
regionalweak expression: see section 02 03 04 05 06 13 14 15 16 17
vestibulocochlear viii ganglion
weak weak
regionalweak expression: see section 04 13 14
spinal cord floor plate
strong strong
regionalstrong expression: see section 07 08
spinal cord meninges
weak weak
regionalweak expression: see section 05 06 07 08 09 13
dorsal root ganglion
weak weak
regionalweak expression: see section 04 05 09 10 11
otic capsule
weak weak
regionalweak expression: see section 05 06 07 11 12 13
viscerocranium
moderate moderate
regionalExpression in the turbinate bone.
tongue muscle
weak weak
regionalweak expression: see section 09 10 11 12
stomach
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07 08
midgut
weak weak
regionalweak expression: see section 08 09 10 11 12 13 14 15
lung
weak weak
regionalweak expression: see section 02 03 04 05 06 07 08 09 10 11 13 14 15
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36826
Entity Detected:Mtss1l, metastasis suppressor 1-like ( MGI:3039591)
Sequence:sense strand is shown

>T36826
GACTGGGTTTAGGGACAGTCAGGCATTGGGAAGCCAGGCTTGCTCATGGGAAAGAGCCCTGGAGGGAGGG
AACGTAGGGGCCTTGTCTCAGGGGACCCTCCAGTTCCCTGTGAAGAGTAACTAGTGGGGTGAGGCAAGGC
AGACAGGGAATGAGTCCAGAGGTACCAGGTGTTTTGGATGCCCTGTTCTTGTCTGGACACTTTGGAGCTT
TTACTCTAGGGGCGCCTTCGGGTTACAGTGTCACCTGTTGCTGGAGATAAGGGCTGGAGCATTAGATGGT
GTGGGGGTTATTTTATGACTGTAATAAAATGGAGCTGACCCTAGACAAAGAACTATGTGGGGCAAGCTGG
TGGTACAGGGTGTACGTCTGAGTGCCTGAGAGAGGGGTGTGGGAGCCCTCAGTGGGCTCGAGGCCAGAGA
AGGGTAGAATCACTCCCCCCAAACCGGGGGAAGCTGCTCTTCTCGCCAGTGTCTGAAGTGTCGGTAGAAT
AAGGCTGGTGAGGGTAGGCCAGGGACTCTGGCCAGTCTGTTGAGATCTGAGCAAGCTGCAGGCCCGGCTT
GGAGCAAGTATTAGAAGGTTGGTTTGACTTTCTGTTGCCAGAGGCAACACCATCCCAAGAAAGTCTATGC
CTACAGGCCTAGCTGGGGCTGGCAGCAGGGACCAGAGGAAGAGTGGGTCCTGCCTCCCTGTCAGCCCAAG
TCTGAGCAAGACTAAGCACGTAAGTGTAAGCCAGAGGAGAGATTCGGGAGGTAGAGCAGGCAGCAGACTC
CAAGGTAGCATTCTGCC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 72582. Forward Primer - name:072582_F_cDNA_BC060632, sequence:GACTGGGTTTAGGGACAGTCAG; Reverse Primer - name:072582_N_SP6_cDNA_BC060632, sequence:GGCAGAATGCTACCTTGGAGT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:19966 same embryo
 EMAGE:19961 same embryo
 EMAGE:19965 same embryo
 EMAGE:19962 same embryo
 EMAGE:19963 same embryo
 EurExpress:euxassay_009417 same experiment
 MGI:4826501 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS