Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:20039

Slc6a15 solute carrier family 6 (neurotransmitter transporter), member 15 ( MGI:2143484)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:20039 EMAGE:20039 EMAGE:20039 EMAGE:20039 EMAGE:20039
"Pseudo-wholemount" of euxassay_012147. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012147_01 euxassay_012147_02 euxassay_012147_03 euxassay_012147_04
EMAGE:20039 EMAGE:20039 EMAGE:20039 EMAGE:20039 EMAGE:20039
euxassay_012147_05 euxassay_012147_06 euxassay_012147_07 euxassay_012147_08 euxassay_012147_09
EMAGE:20039 EMAGE:20039 EMAGE:20039 EMAGE:20039 EMAGE:20039
euxassay_012147_10 euxassay_012147_11 euxassay_012147_12 euxassay_012147_13 euxassay_012147_14
EMAGE:20039 EMAGE:20039 EMAGE:20039 EMAGE:20039 EMAGE:20039
euxassay_012147_15 euxassay_012147_16 euxassay_012147_17 euxassay_012147_18 euxassay_012147_19
EMAGE:20039 EMAGE:20039 EMAGE:20039 EMAGE:20039
euxassay_012147_20 euxassay_012147_21 euxassay_012147_22 euxassay_012147_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:20039Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
20039_wholemount_strong.wlz
20039_wholemount_moderate.wlz
20039_wholemount_weak.wlz
20039_wholemount_possible.wlz
20039_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:20039_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
medulla oblongata part of 4th ventricle choroid plexus
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
diencephalon lateral wall mantle layer
weak weak
regionalweak expression: see section 09 10 11 12 13 14 15 17 18 19
diencephalon roof plate
strong strong
regionalstrong expression: see section 13 14
choroid invagination
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 15 16 17 18 19
telencephalon mantle layer
moderate moderate
regionalmoderate expression: see section 02 03 weak expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
medulla oblongata alar plate mantle layer
weak weak
regionalweak expression: see section 07 08 09 10 11 12 13 14 16 17
medulla oblongata basal plate mantle layer
weak weak
regionalweak expression: see section 07 08 09 10 11 12 13 14 16 17 18
rest of cerebellum mantle layer
weak weak
regionalweak expression: see section 05 06 07 08 09 10 11 12 13 14 16 17 18 19 20
pons mantle layer
weak weak
regionalweak expression: see section 07 08 09 10 11 12 13 14 16 17 18 19
metencephalon part of 4th ventricle choroid plexus
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
midbrain mantle layer
weak weak
regionalweak expression: see section 07 08 09 10 11 12 13 14 15 17 18 19
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 05 18 19 20
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 06 07 17
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 05 06 07 08 17 18 19 20 21 22 weak expression: see section 03 04
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 07 16
vestibulocochlear viii ganglion
strong strong
regionalstrong expression: see section 06 07 08 16 17 18 19 moderate expression: see section 05 21
ventral grey horn
weak weak
regionalweak expression: see section 09 10 11 13 14
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 14 15 16
anterior naris epithelium
strong strong
regionalstrong expression: see section 14 moderate expression: see section 11 12
external naris epithelium
moderate moderate
regionalmoderate expression: see section 11
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 11 14
stomach
moderate moderate
spottedmoderate expression: see section 02 03 04 05 06 07 08 09
midgut
moderate moderate
spottedmoderate expression: see section 10 11 12 13 14
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T37040
Entity Detected:Slc6a15, solute carrier family 6 (neurotransmitter transporter), member 15 ( MGI:2143484)
Sequence:sense strand is shown

>T37040
CTGTTTCTCTCTGATGGTGCTGGCCATACTTCCTGTCCCAGTGGTGTTCATCATTCGTCGCTGCAACCTC
ATAGATGATAGTTCTGGTAACTTGGCCTCCGTGACCTATAAGAGAGGAAGAGTCCTGAAGGAACCTGTGA
ACTTGGAAGGAGATGACGCAAGCCTCATTCATGGAAAGATACCGAGTGAAATGTCATCTCCAAATTTTGG
TAAAAATATTTATCGAAAACAAAGTGGTTCCCCAACACTGGATACTGCTCCCAATGGACGCTATGGGATT
GGGTATTTGATGGCAGACATGCCAGATATGCCAGAGTCTGACTTGTAGCTGAACGAAAGCAGGGGTTGAG
TTTGGTTAATTTTTATCAGTGAGCATCGGTTCTCCTATGAGAAGCATTGGGCTTCACTATCACACGGTGA
TCTCAGGTGTCCATGGCTATGATCTTTAATCCCAACAGTTTTAGACAGTTCAAGAACAGCAATCCTCAGT
TTACATTTGCTCAGAAATGATGGCAGACAAAGCTTACATTGACTGAGGTCATATTTTGCCAGGATTTTTT
AAAAAAACAAGCACTTTGGCATATTTTCAAATATTTCTATCTCTTAAAAAAAGGTGTTACCTCAGTTTCT
AATAATTTCTGGATTTAATATCATTGGCAATTTTAAAAACTCCCTGGTATATCTTACAATTCATAATTTT
GCCTTCAGCATAAGTTCCAGTATTACCATGAACAGTTGTGTGAGCCGGTGCCTCTCAGCACATTCCCATG
AGTATG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 68497. Forward Primer - name:068497_F_cDNA_Slc6a15, sequence:CTGTTTCTCTCTGATGGTGCTG; Reverse Primer - name:068497_N_SP6_cDNA_Slc6a15, sequence:CATACTCATGGGAATGTGCTG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:20040 same embryo
 EMAGE:20037 same embryo
 EMAGE:20042 same embryo
 EMAGE:20041 same embryo
 EMAGE:20038 same embryo
 EurExpress:euxassay_012147 same experiment
 MGI:4828261 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS