Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:20093

Qk quaking ( MGI:97837)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:20093 EMAGE:20093 EMAGE:20093 EMAGE:20093 EMAGE:20093
"Pseudo-wholemount" of euxassay_012259. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012259_01 euxassay_012259_02 euxassay_012259_03 euxassay_012259_04
EMAGE:20093 EMAGE:20093 EMAGE:20093 EMAGE:20093 EMAGE:20093
euxassay_012259_05 euxassay_012259_06 euxassay_012259_07 euxassay_012259_08 euxassay_012259_09
EMAGE:20093 EMAGE:20093 EMAGE:20093 EMAGE:20093 EMAGE:20093
euxassay_012259_10 euxassay_012259_11 euxassay_012259_12 euxassay_012259_13 euxassay_012259_14
EMAGE:20093 EMAGE:20093 EMAGE:20093 EMAGE:20093 EMAGE:20093
euxassay_012259_15 euxassay_012259_16 euxassay_012259_17 euxassay_012259_18 euxassay_012259_19
EMAGE:20093 EMAGE:20093 EMAGE:20093 EMAGE:20093
euxassay_012259_20 euxassay_012259_21 euxassay_012259_22 euxassay_012259_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:20093Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
20093_wholemount_strong.wlz
20093_wholemount_moderate.wlz
20093_wholemount_weak.wlz
20093_wholemount_possible.wlz
20093_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:20093_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
diaphragm
weak weak
regionalweak expression: see section 02 03 04 05 06 07 15 16 17 18 19
vertebral axis musculature
moderate moderate
regionalmoderate expression: see section 01 02 03 06 07 08 09 10 11 15 16 20 21 22 23 weak expression: see section 04 05 12 13 14 17 18 19
submandibular gland primordium
weak weak
regionalweak expression: see section 08 09 10 17 18
vibrissa
moderate moderate
regionalmoderate expression: see section 19 weak expression: see section 04 05 06 07 16 17 18
hypothalamus mantle layer
moderate moderate
spottedmoderate expression: see section 08 09 10 11 12 13 14 15 16
hypothalamus ventricular layer
strong strong
homogeneousstrong expression: see section 11 12 13 14
diencephalon lateral wall mantle layer
moderate moderate
spottedmoderate expression: see section 08 09 10 11 12 13 14 15 16 17
diencephalon lateral wall ventricular layer
strong strong
homogeneousstrong expression: see section 11 12 13
diencephalon meninges
weak weak
regionalweak expression: see section 08 09 10 11 12 13 14 15 16 17
telencephalon mantle layer
moderate moderate
spottedmoderate expression: see section 01 02 03 04 05 06 08 09 10 11 12 14 15 16 17 18 19 20 21
telencephalon meninges
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
olfactory cortex marginal layer
moderate moderate
regionalmoderate expression: see section 09 10 11 13 14 15
olfactory cortex ventricular layer
strong strong
homogeneousstrong expression: see section 09 10 11 13 14 15
telencephalon ventricular layer
strong strong
homogeneousstrong expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
medulla oblongata basal plate mantle layer
moderate moderate
spottedmoderate expression: see section 08 09 10 11 12 13 14 15 16 17 18
medulla oblongata basal plate ventricular layer
strong strong
homogeneousstrong expression: see section 10 11 12 13 14 15 16 17
hindbrain meninges
weak weak
regionalweak expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
cerebellum intraventricular portion mantle layer
moderate moderate
spottedmoderate expression: see section 05 06 08 17 18 19 20
cerebellum intraventricular portion ventricular layer
strong strong
homogeneousstrong expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
pons ventricular layer
strong strong
homogeneousstrong expression: see section 07 08 09 10 11 12 13 14 15 16 17 18
midbrain meninges
weak weak
regionalweak expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18 19
midbrain mantle layer
moderate moderate
spottedmoderate expression: see section 08 09 10 11 12 13 14 15 16 17 18 19
midbrain ventricular layer
strong strong
homogeneousstrong expression: see section 08 09 10 11 12 13 14 15 16 17
dorsal grey horn
moderate moderate
single cellmoderate expression: see section 11 12 14 15 16
ventral grey horn
strong strong
regionalstrong expression: see section 15 moderate expression: see section 11 12 13 14 16
spinal cord ventricular layer
strong strong
regionalstrong expression: see section 13 14
spinal cord meninges
weak weak
regionalweak expression: see section 10 11 12 13 14 15 16 17
dorsal root ganglion
weak weak
regionalweak expression: see section 10 16 17
lens
weak weak
regionalweak expression: see section 01 23
neural retina
weak weak
regionalweak expression: see section 01 02 03 21 22 23
heart ventricle
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14 15 16
tongue muscle
weak weak
regionalweak expression: see section 11 12 13 14
stomach
weak weak
regionalweak expression: see section 04 05 06 07 08 09
midgut
weak weak
regionalweak expression: see section 07 08 11 12
mandible
moderate moderate
regionalmoderate expression: see section 02 weak expression: see section 04 05 06 07 08 09 15 16 17 18 19 20 21
maxilla
weak weak
regionalweak expression: see section 05 06 07 08 09 16 17 18 19 20
lung
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 13 14 15 16 weak expression: see section 04 05 06 12 17 18 19
exoccipital bone
weak weak
regionalweak expression: see section 02 03 22
temporal bone petrous part
weak weak
regionalweak expression: see section 03 22 23
vault of skull
weak weak
regionalweak expression: see section 01 02 03 23
orbito-sphenoid
moderate moderate
regionalmoderate expression: see section 09 20 21 weak expression: see section 01 02 03 04 08 22 23
viscerocranium
moderate moderate
regionalExpression in the turbinate bone.
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30399
Entity Detected:Qk, quaking ( MGI:97837)
Sequence:sense strand is shown

>T30399
GAAGGAGAAGCCGAAGCCCACCCCAGATTATTTGATGCAGCTGATGAACGACAAGAAGCTCATGAGCAGC
CTGCCCAACTTCTGCGGGATCTTCAACCACCTCGAGCGGCTGCTGGACGAAGAAATTAGCAGAGTACGGA
AAGACATGTACAATGACACGTTAAATGGCAGTACAGAGAAAAGAAGTGCAGAATTGCCTGACGCGGTGGG
ACCCATTGTTCAGTTACAAGAGAAACTTTATGTGCCTGTAAAAGAATACCCTGATTTTAATTTTGTTGGG
AGAATCCTTGGACCTAGAGGACTTACAGCTAAACAACTTGAAGCAGAAACGGGATGTAAAATAATGGTCC
GAGGCAAAGGCTCAATGAGGGATAAAAAGAAGGAGGAGCAAAATAGAGGCAAGCCCAATTGGGAGCATCT
AAATGAAGACTTACATGTACTAATCACTGTGGAAGATGCTCAGAACAGAGCAGAAATCAAGCTGAAGAGA
GCGGTTGAAGAAGTGAAGAAGTTACTGGTACCTGCGGCTGAAGGTGAAGACAGCCTGAAGAAGATGCAGC
TGATGGAGCTTGCAATTCTGAATGGCACCTACAGAGACGCCAACATTAAATCACCAGCCCTTGCCTTTTC
TCTTGCAGCAACTGCCCAGGCTGCTCCAAGGATCATCACTGGGCCTGCGCCTGTCCTCCCACCAGCTGCT
CTGCGTACACCTACGCCAGCTGGCCCTACCATAATGCCTTTGATCAGACAAATACAGACCGCTGTCATGC
CAAACGGAACTCCTCACCCAACTGCTGCAATAGTCCCTCCAGGGCCTGAAGCTGGGTTAATCTACACACC
CTATGAATACCCCTACACATTGGCAC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:6335004), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 58526. Forward Primer - name:058526_F_IRAV103_c09_Qk, sequence:GAAGGAGAAGCCGAAGCC; Reverse Primer - name:058526_R_SP6_IRAV103_c09_Qk, sequence:GGTGCCAATGTGTAGGGG. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:20094 same embryo
 EMAGE:20095 same embryo
 EMAGE:20092 same embryo
 EMAGE:20096 same embryo
 EurExpress:euxassay_012259 same experiment
 MGI:4827557 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS