Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:20236

Daam2 dishevelled associated activator of morphogenesis 2 ( MGI:1923691)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:20236 EMAGE:20236 EMAGE:20236 EMAGE:20236 EMAGE:20236
"Pseudo-wholemount" of euxassay_012300. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012300_01 euxassay_012300_02 euxassay_012300_03 euxassay_012300_04
EMAGE:20236 EMAGE:20236 EMAGE:20236 EMAGE:20236 EMAGE:20236
euxassay_012300_05 euxassay_012300_06 euxassay_012300_07 euxassay_012300_08 euxassay_012300_09
EMAGE:20236 EMAGE:20236 EMAGE:20236 EMAGE:20236 EMAGE:20236
euxassay_012300_10 euxassay_012300_11 euxassay_012300_12 euxassay_012300_13 euxassay_012300_14
EMAGE:20236 EMAGE:20236 EMAGE:20236 EMAGE:20236 EMAGE:20236
euxassay_012300_15 euxassay_012300_16 euxassay_012300_17 euxassay_012300_18 euxassay_012300_19
EMAGE:20236 EMAGE:20236 EMAGE:20236 EMAGE:20236
euxassay_012300_20 euxassay_012300_21 euxassay_012300_22 euxassay_012300_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:20236Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
20236_wholemount_strong.wlz
20236_wholemount_moderate.wlz
20236_wholemount_weak.wlz
20236_wholemount_possible.wlz
20236_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:20236_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
rib
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07 20 21 22 23
hindlimb digit 1 phalanx
weak weak
regionalweak expression: see section 04 22
hindlimb digit 2 phalanx
weak weak
regionalweak expression: see section 04 05 06 22
hindlimb digit 3 phalanx
weak weak
regionalweak expression: see section 04 05 06
hindlimb digit 4 phalanx
weak weak
regionalweak expression: see section 04 05 06
hindlimb digit 5 phalanx
weak weak
regionalweak expression: see section 04 05 06
fibula
weak weak
regionalweak expression: see section 01 22 23
tibia
weak weak
regionalweak expression: see section 01 22 23
vibrissa
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 16 17 18 19
diencephalon lateral wall ventricular layer
moderate moderate
regionalmoderate expression: see section 14 weak expression: see section 11 12 13
telencephalon ventricular layer
weak weak
regionalweak expression: see section 03 04 05 06 17 18 19 20 21
medulla oblongata basal plate ventricular layer
strong strong
regionalstrong expression: see section 13 14 15 16
pons ventricular layer
strong strong
regionalstrong expression: see section 08 09 10 11 12 13 14 15 16 17 moderate expression: see section 18 19
midbrain ventricular layer
strong strong
regionalstrong expression: see section 10 11 12 13 14 15 16 17
spinal cord ventricular layer
strong strong
regionalstrong expression: see section 13 14 15
viscerocranium
weak weak
regionalExpression in the turbinate bone.
mandible
moderate moderate
regionalmoderate expression: see section 20 21 weak expression: see section 03 04 05 16 17 18 19
lower jaw molar
weak weak
regionalweak expression: see section 05 06 16 17
upper jaw molar
weak weak
regionalweak expression: see section 05 06 16 17
genital tubercle of male
weak weak
regionalweak expression: see section 09 10 11 12 13
testis
weak weak
regionalweak expression: see section 05 06 07 18 19 20
lung
moderate moderate
regionalmoderate expression: see section 12 13 14 15 16 18 19 20 21 22 23 weak expression: see section 04 05 06 07 08 09 10 11 17
trachea
weak weak
regionalweak expression: see section 14 15
clavicle
weak weak
regionalweak expression: see section 10 11 16
axial skeleton tail region
weak weak
regionalweak expression: see section 10 11
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30467
Entity Detected:Daam2, dishevelled associated activator of morphogenesis 2 ( MGI:1923691)
Sequence:sense strand is shown

>T30467
TGCAGAGCTGGTGGATGAATTGGACCTCACAGATAAAAACCGAGAGGCTGTGTTTGCACTACCACCCGAG
AAGAAATGGCAGATCTACTGCAGCAAGAGGAAGGAGCAGGAGGATCCCAACAAGCTGGCAACCAGTTGGC
CTGAGTACTACATTGATCGTATCAATGCCATGGCCGCCATGCAGAATCTGTATGAAACTGAAGATGAGGA
GACAGACAAGAGGAACCAAGTTGTAGAAGACCTGAAGACAGCCCTCCGGACACAACCCATGAGGTTTGTG
ACCCGCTTCATCGATCTGGAAGGCCTGACCTGTCTGCTGAATTTCCTCCGGGGCATGGACCACACCACCT
GTGAAAGCCGCATCCACACATCTCTCATTGGCTGCATCAAGGCTCTGATGAACAACTCTCAGGGCCGGGC
ACACGTCCTGGCACAACCTGAGGCCATCAGCATCATCGCTCAGAGCCTGCGCACAGAGAACAGCAAGACC
AAAGTTGCAGTGCTGGAGATCCTGGGTGCAGTATGCCTTGTACCCGGAGGCCACAAGAAGGTTCTACAGG
CCATGCTACACTATCAGGCGTATGCAGCCGAGCGCACTCGTTTCCAGACTTTGCTGAATGAACTGGATCG
AAGCTTAGGCCGCTACCGGGATGAGGTAAACCTGAAGACAGCCATCATGTCCTTCATCAATGCTGTCCTC
AATGCTGGCGCTGGAGAGGATAACCTGGAATTCCGCCTGCATCTCCGGTATGAGTTCCTGATGCTGGGGA
TCCAGCCAGTGATTGATAAACTCCGGCAACACGAGAATGCCATCCTGGACAAGCATTTAGACTTCTTTGA
GATGGTCCGGAATGAGGATGACCTGGAGCTAGCCAGGAGGTTTGACATGGTCCACATTGACACAAAAAGT
GCCTCCCAGATGTTTGAGCTGATCCACAAGAAGCTGAAGCACACGGAAGCCTATCCCTGCCTGC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:6432883), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 58916. Forward Primer - name:058916_F_IRAV106_h07_Daam2, sequence:TGCAGAGCTGGTGGATGA; Reverse Primer - name:058916_R_SP6_IRAV106_h07_Daam2, sequence:AGCAGGCAGGGATAGGCT. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:20237 same embryo
 EMAGE:20240 same embryo
 EMAGE:20235 same embryo
 EMAGE:20239 same embryo
 EMAGE:20238 same embryo
 EurExpress:euxassay_012300 same experiment
 MGI:4824215 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS