Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:20237

AW555464 expressed sequence AW555464 ( MGI:2145043)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:20237 EMAGE:20237 EMAGE:20237 EMAGE:20237 EMAGE:20237
"Pseudo-wholemount" of euxassay_012295. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012295_01 euxassay_012295_02 euxassay_012295_03 euxassay_012295_04
EMAGE:20237 EMAGE:20237 EMAGE:20237 EMAGE:20237 EMAGE:20237
euxassay_012295_05 euxassay_012295_06 euxassay_012295_07 euxassay_012295_08 euxassay_012295_09
EMAGE:20237 EMAGE:20237 EMAGE:20237 EMAGE:20237 EMAGE:20237
euxassay_012295_10 euxassay_012295_11 euxassay_012295_12 euxassay_012295_13 euxassay_012295_14
EMAGE:20237 EMAGE:20237 EMAGE:20237 EMAGE:20237 EMAGE:20237
euxassay_012295_15 euxassay_012295_16 euxassay_012295_17 euxassay_012295_18 euxassay_012295_19
EMAGE:20237 EMAGE:20237 EMAGE:20237 EMAGE:20237 EMAGE:20237
euxassay_012295_20 euxassay_012295_21 euxassay_012295_22 euxassay_012295_23 euxassay_012295_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:20237Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
20237_wholemount_strong.wlz
20237_wholemount_moderate.wlz
20237_wholemount_weak.wlz
20237_wholemount_possible.wlz
20237_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:20237_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 07 08 09 17 weak expression: see section 16 18
vibrissa
weak weak
regionalweak expression: see section 02 03 04 05 16 17 18
diencephalon lateral wall mantle layer
weak weak
regionalweak expression: see section 07 08 10 11 13 14 15 16 17
lateral ventricle
weak weak
regionalweak expression: see section 21
telencephalon mantle layer
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07 08 09 10 12 13 14 16
olfactory cortex mantle layer
weak weak
regionalweak expression: see section 07 08 09 12 13 14
medulla oblongata basal plate mantle layer
weak weak
regionalweak expression: see section 10 11 17
neural retina
weak weak
regionalweak expression: see section 01 02 21 22 23
nasal cavity olfactory epithelium
weak weak
regionalweak expression: see section 05 06 07 08 09 10 11 12 13 14 15 16
stomach
weak weak
regionalweak expression: see section 02 03 04 05 06 07 08 09 10
rectum
weak weak
regionalweak expression: see section 11
midgut
weak weak
regionalweak expression: see section 10 11 12 13 14 15
lower jaw incisor
weak weak
regionalweak expression: see section 08 09 12 13
lower jaw molar
weak weak
regionalweak expression: see section 06 17
upper jaw incisor
weak weak
regionalweak expression: see section 08 09 12 13
upper jaw molar
weak weak
regionalweak expression: see section 05 06 17 18
bladder
weak weak
regionalweak expression: see section 12
metanephros
weak weak
regionalweak expression: see section 07 08 09 16 17 18
urethra of male
weak weak
regionalweak expression: see section 11 12
lung
weak weak
regionalweak expression: see section 05 06 07 08 09 10 11 17 18 19 20 21 22 23
trachea
weak weak
regionalweak expression: see section 14
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30468
Entity Detected:AW555464, expressed sequence AW555464 ( MGI:2145043)
Sequence:sense strand is shown

>T30468
CATCAATGCCATCGTGGACCCCAGCTTGAACCTCGACCTACTGATGGGAAACAGGGCTCCTTCAGGGTCT
GGCCAGCCAGGACTTGGGAAAGCCAGGCCAGCAGCTCAGAGCTCAACTTCACCTGCCTCGGTGGATACCT
TGCTGCCAGCCCTGCCTCTCAGGAGCTTCCCACAGCGGGCCAACTGCGGGCCCCCCGGCCTCCCGGAGCC
TGCCTTCCTTCCTGATGCTGAGAGGTTTCTGATCTAAGCTGTGAGGCGGGCAAGGCCAGCCTTCTTCTGC
GCGTGTGTCCTGTGCATCCATCCCACGGCCCACCTGCCTGGCTGCAGGAGGTTCTCTGTGAAAACCCTGT
ATGTGCCATAGCCCCATGGATGGGTGCCTCCCATTTCCAGACCCTCCTCAGCCAGCACCTGAACCACTTC
ATCCAGCCCATGGCGCCCCCCACCTCCACAGGCCTCCCAGCCTAGCCCCTGGGGTGTCCACTGCCAAGGG
CCAGCTGGTGAGGCCCCATATTCACCTCCTGTCAATCACCATTGTTTTTGTTGGTAGCTTTAAAGGAAAG
AGTACATTGCTCCCTTGCAGGAACTTGCAGGCCCCGCTTAGGTCCAGGCCCAGCCTGGGAGGCCCCGTCT
CATCCCTATGTGCTGGCTTGAGGCCAGACAGAGAAAGGAGCTGGACCCTGGGGCCAGTCAGTGCCAAACA
CAGGAGCTGGATGGGTTTGGCATGTCCCCAAACTGCCCAGGAAGGAGGCCACTTGCCTTGTGGCTCCTAC
TGAGTCCACGGCCGGAGCTGCTGCAGAGTCCATCAACCTGGGCAGA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:30022623), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 58878. Forward Primer - name:058878_F_IRAV107_b04_AW555464, sequence:CATCAATGCCATCGTGGA; Reverse Primer - name:058878_R_SP6_IRAV107_b04_AW555464, sequence:GTCTGCCCAGGTTGATGG. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:20236 same embryo
 EMAGE:20240 same embryo
 EMAGE:20235 same embryo
 EMAGE:20239 same embryo
 EMAGE:20238 same embryo
 EurExpress:euxassay_012295 same experiment
 MGI:4823365 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS