Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:20258

Hmgcs2 3-hydroxy-3-methylglutaryl-Coenzyme A synthase 2 ( MGI:101939)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:20258 EMAGE:20258 EMAGE:20258 EMAGE:20258 EMAGE:20258
"Pseudo-wholemount" of euxassay_012378. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012378_01 euxassay_012378_02 euxassay_012378_03 euxassay_012378_04
EMAGE:20258 EMAGE:20258 EMAGE:20258 EMAGE:20258 EMAGE:20258
euxassay_012378_05 euxassay_012378_06 euxassay_012378_07 euxassay_012378_08 euxassay_012378_09
EMAGE:20258 EMAGE:20258 EMAGE:20258 EMAGE:20258 EMAGE:20258
euxassay_012378_10 euxassay_012378_11 euxassay_012378_12 euxassay_012378_13 euxassay_012378_14
EMAGE:20258 EMAGE:20258 EMAGE:20258 EMAGE:20258 EMAGE:20258
euxassay_012378_15 euxassay_012378_16 euxassay_012378_17 euxassay_012378_18 euxassay_012378_19
EMAGE:20258 EMAGE:20258 EMAGE:20258
euxassay_012378_20 euxassay_012378_21 euxassay_012378_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:20258Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
20258_wholemount_strong.wlz
20258_wholemount_moderate.wlz
20258_wholemount_weak.wlz
20258_wholemount_possible.wlz
20258_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:20258_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
medulla oblongata part of 4th ventricle choroid plexus
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 moderate expression: see section 03
head mesenchyme
moderate moderate
regionalmoderate expression: see section 03 04 05 06 10 11 12 13 14 16 17 18 19 20 21 22
trunk mesenchyme
moderate moderate
regionalmoderate expression: see section 06 07 08 14 19 20 21 22
spleen primordium
strong strong
regionalstrong expression: see section 04 05
diencephalon lateral wall mantle layer
strong strong
single cellstrong expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18
diencephalon meninges
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19
choroid invagination
strong strong
regionalstrong expression: see section 06 07 08 09 10 16 17 18
telencephalon mantle layer
strong strong
single cellstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
telencephalon meninges
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 moderate expression: see section 01 02 03 04 21 22
medulla oblongata alar plate mantle layer
strong strong
single cellstrong expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18
medulla oblongata basal plate mantle layer
strong strong
single cellstrong expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18
hindbrain meninges
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 moderate expression: see section 03 04
rest of cerebellum mantle layer
strong strong
single cellstrong expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19
pons mantle layer
strong strong
single cellstrong expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19
metencephalon part of 4th ventricle choroid plexus
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 moderate expression: see section 03
midbrain meninges
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 moderate expression: see section 04
midbrain mantle layer
strong strong
single cellstrong expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 04
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 07 08 19
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 18 19 20 21
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 09
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 05 06 07 19 20
trigeminal v nerve
moderate moderate
regionalmoderate expression: see section 09
spinal cord mantle layer
strong strong
single cellstrong expression: see section 08 09 10 11 12 13 14 15 16
spinal cord meninges
strong strong
regionalstrong expression: see section 09 10 11 12 13 14 15 16 17
dorsal root ganglion
weak weak
regionalweak expression: see section 07 08 09 10 14 15 16 17 18
aorta
moderate moderate
regionalmoderate expression: see section 11 12 13 14 15 16 17
heart valve
strong strong
regionalstrong expression: see section 12 13 14 15 16
liver
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
kidney calyx
moderate moderate
regionalmoderate expression: see section 06 07 08 09 16 17 18
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T31269
Entity Detected:Hmgcs2, 3-hydroxy-3-methylglutaryl-Coenzyme A synthase 2 ( MGI:101939)
Sequence:sense strand is shown

>T31269
CTGTGGCAATGCTGATCGGGCCCAAGGCCCCTCTGGTCCTCGAGCAAGGGCTGAGGGGAACTCACATGGA
GAACGCGTACGACTTCTACAAACCAAACTTGGCCTCAGAGTATCCACTGGTGGATGGGAAGCTGTCTATC
CAGTGCTACCTGCGGGCCTTGGATCGATGCTATGCAGCCTACCGCAAGAAGATCCAGAATCAGTGGAAGC
AAGCTGGAAACAACCAGCCTTTCACCCTCGATGATGTGCAGTATATGATCTTCCACACACCCTTTTGCAA
GATGGTCCAGAAATCCCTGGCTCGGTTGATGTTCAATGACTTCCTGTCATCCAGCAGTGACAAACAGAAC
AACTTATACAAGGGCCTAGAGGCCTTCAGGGGTCTAAAGCTGGAAGAAACCTACACCAACAAGGATGTAG
ACAAGGCTCTTTTGAAGGCCTCCCTGGACATGTTCAACCAGAAGACCAAGGCCTCCCTTTACCTCTCCAC
AAATAATGGGAACATGTACACCTCTTCCCTCTATGGCTGCCTGGCCTCACTTCTCTCTCACCACTCTGCC
CAAGAATTGGCTGGCTCCAGGATTGGAGCCTTCTCCTACGGCTCAGGCTTAGCAGCAAGTTTCTTTTCAT
TCCGAGTGTCCAAGGATGCTTCCCCAGGTTCCCCCCTGGAGAAACTGGTGTCTAGTGTGTCAGATCTGCC
CAAACGTCTAGACTCCCGGAGACGCATGTCCCCTGAGGAATTCACAGAAATAATGAACCAGAGAGAGCAA
TTTTACCACAAGGTGAACTTCTCTCCACCTGGAGACACAAGCAATCTCTTCCCAGGTACTTGGTACCTTG
AACGAGTGGATGAGATGCATCGCAGGAAGTATGCCCGGT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:4216637), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 54948. Forward Primer - name:054948_F_IRAV49_g02_Hmgcs2, sequence:CTGTGGCAATGCTGATCG; Reverse Primer - name:054948_R_SP6_IRAV49_g02_Hmgcs2, sequence:CACCGGGCATACTTCCTG. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:20256 same embryo
 EMAGE:20257 same embryo
 EurExpress:euxassay_012378 same experiment
 MGI:4825394 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS