Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:20282

Rab6a RAB6A, member RAS oncogene family ( MGI:894313)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:20282 EMAGE:20282 EMAGE:20282 EMAGE:20282 EMAGE:20282
"Pseudo-wholemount" of euxassay_012532. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012532_01 euxassay_012532_02 euxassay_012532_03 euxassay_012532_04
EMAGE:20282 EMAGE:20282 EMAGE:20282 EMAGE:20282 EMAGE:20282
euxassay_012532_05 euxassay_012532_06 euxassay_012532_07 euxassay_012532_08 euxassay_012532_09
EMAGE:20282 EMAGE:20282 EMAGE:20282 EMAGE:20282 EMAGE:20282
euxassay_012532_10 euxassay_012532_11 euxassay_012532_12 euxassay_012532_13 euxassay_012532_14
EMAGE:20282 EMAGE:20282 EMAGE:20282 EMAGE:20282 EMAGE:20282
euxassay_012532_15 euxassay_012532_16 euxassay_012532_17 euxassay_012532_18 euxassay_012532_19
EMAGE:20282 EMAGE:20282 EMAGE:20282 EMAGE:20282 EMAGE:20282
euxassay_012532_20 euxassay_012532_21 euxassay_012532_22 euxassay_012532_23 euxassay_012532_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:20282Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
20282_wholemount_strong.wlz
20282_wholemount_moderate.wlz
20282_wholemount_weak.wlz
20282_wholemount_possible.wlz
20282_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:20282_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
brain
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
facial vii ganglion
strong strong
regionalstrong expression: see section 04 05 06 18 19 20 21
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 07
trigeminal v ganglion
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 16 17 18 19 20 21 22
vagus x ganglion
strong strong
regionalstrong expression: see section 07 08 17 18
vestibulocochlear viii ganglion
strong strong
regionalstrong expression: see section 07 17 18 19
trigeminal v nerve
strong strong
regionalstrong expression: see section 08 16
spinal cord
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14 15 16
cervico-thoracic ganglion
moderate moderate
regionalmoderate expression: see section 10 11 16
cervical ganglion
moderate moderate
regionalmoderate expression: see section 08 09 17
thoracic ganglion
moderate moderate
regionalmoderate expression: see section 11 12 13
dorsal root ganglion
strong strong
regionalstrong expression: see section 07 08 09 10 12 13 14 15 16 17 18
neural retina
strong strong
regionalstrong expression: see section 01 02 22 23 24
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 09 10 14 15 moderate expression: see section 07 08 13 16 17
vomeronasal organ
moderate moderate
regionalmoderate expression: see section 10 13
lower jaw incisor
strong strong
regionalstrong expression: see section 10 11 14 15
lower jaw molar
strong strong
regionalstrong expression: see section 18 19 moderate expression: see section 06
upper jaw incisor
strong strong
regionalstrong expression: see section 09 10 14
upper jaw molar
strong strong
regionalstrong expression: see section 18 19 moderate expression: see section 06
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T31403
Entity Detected:Rab6a, RAB6A, member RAS oncogene family ( MGI:894313)
Sequence:sense strand is shown

>T31403
ATCCCCCTGGCATCTTTCAACCCTCCTGCAGAAGCTCACTGCTTTGGCCCCATACTCTTTCATTGACTGC
AGTGTGAATATTGGCTTGAACCTTTTCCCTTCAGTAATAACGTATTGCAATTCATCATTGCTGCCTGTTT
CGTGGAGGTGATCTATTAGCTTCACAAGCACAAAAAAGTCAGTGTCTTTATTATTTATATTTTTTAAAAG
CCAAACAATTCCAGCATACTCGTGATAACTTTGAGGATTAGATACATTTTCTTAACATTTTTTTCCCTTT
TTAATGTTATGATAATGTACTTAAAATGATGAAAATCTCAGCAGTATGTGTGTGGCTTGTTAAAGAGCAG
CGTGTTCATAGCAGCGTTGCCTGCCTTCTTGCTGTCTATCAGCCTTTCTTGCCTCTTCCTTTTCGCCTTC
CCTGTTCTTCCCTTTCTCAAACAAACAAGACATGGCAAACCGCAGTCTAACCCAGCCCTTTGAAATTATC
CATAGTTTTACAGACAGCTCCAGGCTATGAGCCACAATGTCCAAAATTATTCTTGAGCACTGATATAAAT
TACTTAGACCTTCTTTGAGGGCAGAACTCAGCTGTTGCTCTCATGATGGGCAGTGCTGGAAA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:3711087), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 38990. Forward Primer - name:038990_F_IRAV55-58_M20_Rab6, sequence:ATCCCCCTGGCATCTTTC; Reverse Primer - name:038990_R_SP6_IRAV55-58_M20_Rab6, sequence:CTTTCCAGCACTGCCCAT. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:20283 same embryo
 EMAGE:20286 same embryo
 EMAGE:20281 same embryo
 EMAGE:20285 same embryo
 EMAGE:20284 same embryo
 EurExpress:euxassay_012532 same experiment
 MGI:4827585 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS