Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:20340

Pbxip1 pre-B-cell leukemia transcription factor interacting protein 1 ( MGI:2441670)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:20340 EMAGE:20340 EMAGE:20340 EMAGE:20340 EMAGE:20340
"Pseudo-wholemount" of euxassay_012529. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012529_01 euxassay_012529_02 euxassay_012529_03 euxassay_012529_04
EMAGE:20340 EMAGE:20340 EMAGE:20340 EMAGE:20340 EMAGE:20340
euxassay_012529_05 euxassay_012529_06 euxassay_012529_07 euxassay_012529_08 euxassay_012529_09
EMAGE:20340 EMAGE:20340 EMAGE:20340 EMAGE:20340 EMAGE:20340
euxassay_012529_10 euxassay_012529_11 euxassay_012529_12 euxassay_012529_13 euxassay_012529_14
EMAGE:20340 EMAGE:20340 EMAGE:20340 EMAGE:20340 EMAGE:20340
euxassay_012529_15 euxassay_012529_16 euxassay_012529_17 euxassay_012529_18 euxassay_012529_19
EMAGE:20340 EMAGE:20340 EMAGE:20340 EMAGE:20340
euxassay_012529_20 euxassay_012529_21 euxassay_012529_22 euxassay_012529_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:20340Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
20340_wholemount_strong.wlz
20340_wholemount_moderate.wlz
20340_wholemount_weak.wlz
20340_wholemount_possible.wlz
20340_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:20340_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
medulla oblongata part of 4th ventricle choroid plexus
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
diaphragm
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14
diencephalon lateral wall ventricular layer
moderate moderate
regionalmoderate expression: see section 11 12 13
choroid invagination
moderate moderate
regionalmoderate expression: see section 07 08 09 10 15 16 17 18 19
telencephalon ventricular layer
moderate moderate
regionalmoderate expression: see section 05 06 07 08 12 18 19 20 21 weak expression: see section 02 03 04
medulla oblongata floor plate
moderate moderate
regionalmoderate expression: see section 12
medulla oblongata alar plate ventricular layer
moderate moderate
regionalmoderate expression: see section 09 10 11 13 14
medulla oblongata basal plate ventricular layer
moderate moderate
regionalmoderate expression: see section 11 12 13
metencephalon floor plate
moderate moderate
regionalmoderate expression: see section 12
pons ventricular layer
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18
metencephalon part of 4th ventricle choroid plexus
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
midbrain ventricular layer
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14 15 16 17
spinal cord ventricular layer
moderate moderate
regionalmoderate expression: see section 11 12
heart ventricle
moderate moderate
spottedmoderate expression: see section 06 07 08 09 10 11 12 13 weak expression: see section 14
tongue muscle
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13
stomach
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 08 09
midgut
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 15 16 17
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T31356
Entity Detected:Pbxip1, pre-B-cell leukemia transcription factor interacting protein 1 ( MGI:2441670)
Sequence:sense strand is shown

>T31356
AGAGTCCCAGGGAGTGGGGTGGGAAGGAGAAGTGGCGCGGTGGGCAGAGGGATCAGAAGGCTGAGCACTG
GAAGCCGAGGAAGGAGGAGTCTGGCCAGGAGAGGCAAAGGAGCTGGAGGGATGAGGGCCGGGAGCACACT
GGGCGCTGGAGGGAGGACAGACTGCGGGCGGACGAATCTGGGAGCAGAAAGGACAGCAAGCGACAGGACC
CCAAGGTACACCCTAGGAAAGATGGGAACTCCCATTCTGTAGAAAGGCAGAAGCATTCTTGGGGGAAAGA
CAACAGCCCTGACGCCCTGTCCTCCTGGGAGGAGCTGCTGAGGCGCAAGTACCGACCCCCTCAGGGCTGT
TCAGGTGTGGCCGACTGTGCCCGGCAGGAGGGCCTGGCCCTCTTTGGTGTGGAGCTGGCCCCTGTGCGGC
AGCAGGAGCTGGCCTCTGTGCTGAGAGAATACTTGTCTCGGCTGCCCTGGGCCGGGCAGCTGACCAAACA
GCTGCCCCTCTCACCTGCTTACTTTGGAGAAGATGGCATCTTCAGGCATGACCGGCTTCGCTTCAGAGAT
TTTGTGGATGCCTTGGAGGACAGCCTGGAGGAGGTGGCACTGAAACAGACAGGCGACGATGATGAAGTGG
ATGACTTTGAGGACTTTGTCTTCGGCCACTTCTTTGGGGACAAGGCCCTGAAGAAGAGGTCACGAAAGAA
GGAGAAGCACTCCTGGAACCCCAGAGTTGTGGGGCCCAGGGAAGAGCACAGCCGCCATCCGCACCACTAC
CACCAAGGCTGAGCCCTGTCCTGCTGCAACAGCCGGCCTTGGCATGCACCCAGCTCAAGATGCCTGGAGT
TATGTGACCCTAGCAGCTATGCTCCCACTGTCCAGCGGGCCCCTCCTGGCTCGTTGGTGCCCTTGAA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:4460993), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 20415. Forward Primer - name:020415_F_IRAV55-58_A22_Pbxip1, sequence:AGAGTCCCAGGGAGTGGG; Reverse Primer - name:020415_R_SP6_IRAV55-58_A22_Pbxip1, sequence:ATTCAAGGGCACCAACGA. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:20341 same embryo
 EMAGE:20339 same embryo
 EMAGE:20338 same embryo
 EMAGE:20337 same embryo
 EurExpress:euxassay_012529 same experiment
 MGI:4827071 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS