Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:20384

Dlgap4 discs, large homolog-associated protein 4 (Drosophila) ( MGI:2138865)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:20384 EMAGE:20384 EMAGE:20384 EMAGE:20384 EMAGE:20384
"Pseudo-wholemount" of euxassay_012602. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012602_01 euxassay_012602_02 euxassay_012602_03 euxassay_012602_04
EMAGE:20384 EMAGE:20384 EMAGE:20384 EMAGE:20384 EMAGE:20384
euxassay_012602_05 euxassay_012602_06 euxassay_012602_07 euxassay_012602_08 euxassay_012602_09
EMAGE:20384 EMAGE:20384 EMAGE:20384 EMAGE:20384 EMAGE:20384
euxassay_012602_10 euxassay_012602_11 euxassay_012602_12 euxassay_012602_13 euxassay_012602_14
EMAGE:20384 EMAGE:20384 EMAGE:20384 EMAGE:20384 EMAGE:20384
euxassay_012602_15 euxassay_012602_16 euxassay_012602_17 euxassay_012602_18 euxassay_012602_19
EMAGE:20384 EMAGE:20384
euxassay_012602_20 euxassay_012602_21

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:20384Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
20384_wholemount_strong.wlz
20384_wholemount_moderate.wlz
20384_wholemount_weak.wlz
20384_wholemount_possible.wlz
20384_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:20384_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
hypothalamus mantle layer
moderate moderate
homogeneousmoderate expression: see section 06 07 08 09 10 11 12 13 14 not examined expression: see section 05
diencephalon lateral wall mantle layer
moderate moderate
homogeneousmoderate expression: see section 06 07 08 09 10 11 12 13 14 15 16 not examined expression: see section 05
telencephalon mantle layer
moderate moderate
homogeneousmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
medulla oblongata alar plate mantle layer
moderate moderate
homogeneousmoderate expression: see section 05 06 07 08 09 10 11 12 13 14 15 16
medulla oblongata basal plate mantle layer
moderate moderate
homogeneousmoderate expression: see section 05 06 07 08 09 10 11 12 13 14 15 16
metencephalon rest of alar plate mantle layer
moderate moderate
homogeneousmoderate expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19
pons mantle layer
moderate moderate
homogeneousmoderate expression: see section 05 06 07 08 09 10 11 12 13 14 15 16
midbrain mantle layer
moderate moderate
homogeneousmoderate expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 not examined expression: see section 02 03
facial vii ganglion
weak weak
regionalweak expression: see section 02 03 04 17 18 19
glossopharyngeal ix ganglion
weak weak
regionalweak expression: see section 05 16
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 20 weak expression: see section 01 02 03 04 05 06 14 15 16 17 18 19
vagus x ganglion
weak weak
regionalweak expression: see section 06 15
vestibulocochlear viii ganglion
weak weak
regionalweak expression: see section 05 16
trigeminal v nerve
weak weak
regionalweak expression: see section 07 14
spinal cord mantle layer
moderate moderate
homogeneousmoderate expression: see section 07 08 09 10 11 12 13 14
cervico-thoracic ganglion
weak weak
regionalweak expression: see section 08 14
cervical ganglion
weak weak
regionalweak expression: see section 07 14
dorsal root ganglion
weak weak
regionalweak expression: see section 07 08 09 11 12 13 14 15 16
neural retina
moderate moderate
regionalmoderate expression: see section 01 20 21
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T31572
Entity Detected:Dlgap4, discs, large homolog-associated protein 4 (Drosophila) ( MGI:2138865)
Sequence:sense strand is shown

>T31572
GGGGTGGAATTACCCCAGGCCCTGAAGCTCCGGAGCCACCCCCTAAGCATGCAGCTCTGAAGAGTGAACA
AGGGACACTGACGAGCTCTGAGTCCCATTCCGAGGCCATCCCCAAAAGGAAACTGTCATCGATAGGAATA
CAAGTTGACTGCATTCAGCCAGTGCCAAAAGAGGAGCCCAGTCCCGCTACCAAATTCCAGTCCATCGGGG
TTCAGGTAGAGGACGACTGGCGAAGCAGTGCCCCCTCTCACAGCATGTCCTCCCGTCGGGACACTGACTC
TGATACCCAGGATGCCAACGACTCCAGTTGTAAGTCATCTGAGAGGAGTCTCCCAGACTGTACCTCACAC
CCCAATTCCATCAGCATTGATGCTGGCCCCCGACAGGCCCCCAAGATTGCCCAGATCAAGCGCAACCTCT
CCTATGGAGACAACAGCGACCCTGCCCTGGAGGTGTCTTCGCTGCCCCCACCCGACCCTTGGCTGGAGAC
TTCCTCCAGCTCCCCAGCAGAGCCCGCTCAGCCAGGGGCCTGCCGCAGGGATGGCTACTGGTTCCTGAAG
CTCCTTCAGGCAGAAACGGAGAGACTGGAAGGCTGGTGCTGCCAGATGGACAAGGAGACCAAAGAGAACA
ACCTCTCTGAAGAAGTCTTAGGGAAAGTTCTCAGTGCTGTGGGCAGCGCCCAGCTCCTGATGTCCCAGAA
ATTCCAGCAGTTCCGCGGCCTCTGTGAGCAGAACTTGAACCCTGATGCCAACCCCCGTCCGACAGCCCAG
GACCTGGCAGGGTTCTGGGACCTGCTGCAGCTGTCCATTGAGGACATCAGCATGAAGTTCGATGAGCTCT
ACCACCTCAAGGCCAAC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:5002845), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 30498. Forward Primer - name:030498_F_IRAV71-74_D21_Dlgap4, sequence:GGGGTGGAATTACCCCAG; Reverse Primer - name:030498_R_SP6_IRAV71-74_D21_Dlgap4, sequence:TGTTGGCCTTGAGGTGGT. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:20383 same embryo
 EMAGE:20387 same embryo
 EMAGE:20382 same embryo
 EMAGE:20386 same embryo
 EMAGE:20385 same embryo
 EurExpress:euxassay_012602 same experiment
 MGI:4824324 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS