Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:20430

Fam57b family with sequence similarity 57, member B ( MGI:1916202)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:20430 EMAGE:20430 EMAGE:20430 EMAGE:20430 EMAGE:20430
"Pseudo-wholemount" of euxassay_012652. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012652_01 euxassay_012652_02 euxassay_012652_03 euxassay_012652_04
EMAGE:20430 EMAGE:20430 EMAGE:20430 EMAGE:20430 EMAGE:20430
euxassay_012652_05 euxassay_012652_06 euxassay_012652_07 euxassay_012652_08 euxassay_012652_09
EMAGE:20430 EMAGE:20430 EMAGE:20430 EMAGE:20430 EMAGE:20430
euxassay_012652_10 euxassay_012652_11 euxassay_012652_12 euxassay_012652_13 euxassay_012652_14
EMAGE:20430 EMAGE:20430 EMAGE:20430 EMAGE:20430 EMAGE:20430
euxassay_012652_15 euxassay_012652_16 euxassay_012652_17 euxassay_012652_18 euxassay_012652_19
EMAGE:20430 EMAGE:20430
euxassay_012652_20 euxassay_012652_21

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:20430Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
20430_wholemount_strong.wlz
20430_wholemount_moderate.wlz
20430_wholemount_weak.wlz
20430_wholemount_possible.wlz
20430_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:20430_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
hypothalamus mantle layer
strong strong
homogeneousstrong expression: see section 06 07 08 09 10 12 13 14 moderate expression: see section 11
diencephalon lateral wall mantle layer
strong strong
homogeneousstrong expression: see section 06 07 08 09 10 12 13 14 15 moderate expression: see section 11
telencephalon mantle layer
strong strong
homogeneousstrong expression: see section 01 02 03 04 05 06 07 08 09 10 12 13 14 15 16 17 18 19 20 moderate expression: see section 11
medulla oblongata alar plate mantle layer
strong strong
homogeneousstrong expression: see section 06 08 09 10 11 12 13 14 15
medulla oblongata basal plate mantle layer
strong strong
homogeneousstrong expression: see section 06 07 08 09 10 11 12 13 14 15 16
rest of cerebellum mantle layer
strong strong
homogeneousstrong expression: see section 03 04 05 06 07 08 09 10 12 13 14 15 16 17 18 moderate expression: see section 11
pons mantle layer
strong strong
homogeneousstrong expression: see section 06 07 08 09 10 11 12 13 14 15 16
midbrain mantle layer
strong strong
homogeneousstrong expression: see section 04 05 06 07 08 09 10 12 13 14 15 16 moderate expression: see section 11
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 04 05 17 18
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 07 16 17 weak expression: see section 06
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 08 15 16 17 18 19
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 08 15 16
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 06 07 08 15 16 17
spinal cord mantle layer
strong strong
homogeneousstrong expression: see section 06 07 08 09 10 11 12 13 14
cervico-thoracic ganglion
weak weak
regionalweak expression: see section 14
thoracic ganglion
weak weak
regionalweak expression: see section 09 10
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 05 10 11 12 13 14 15 16 weak expression: see section 06 07 08
neural retina
moderate moderate
regionalmoderate expression: see section 01 02 03 20 21
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T32152
Entity Detected:Fam57b, family with sequence similarity 57, member B ( MGI:1916202)
Sequence:sense strand is shown

>T32152
CAGTGGTGTGGCGACAAGGCAAGGGAGATTTCTTTCTAGGCTGCATGTTGATGGCCGAGGTCAGCACTCC
TTTCGTCTGCCTGGGCAAGATCCTCATTCAGTACAAGCAGCAGCACACGTTGCTGCACAAGGTGAACGGA
GCCCTGATGCTACTCAGCTTCCTGTGCTGCCGGGTGCTGCTCTTCCCCTACCTGTACTGGGCCTACGGGC
GCCACGCTGGCCTGCCCCTGCTCTCAGTGCCCATGGCCATCCCGGCCCACGTCAACCTGGGCGCCGCACT
GCTCCTCGCACCCCAGCTCTACTGGTTCTTCCTCATTTGCCGCGGGGCCTGCCGCCTCTTCCGACCCCGA
GGCTCCCCACCACCCTCTCCTTGTCAGACCCAGGACTGAGGCTAGGCCCTGGAAACCCTCCCCCCCCTCC
AGCCCCTGTGGAGACAGTGCATTGGGGTAATCAGTGTGTGAGTTGGGGGGGGGGGGACGAGAGCCAGAAG
TCCCTTTCCTTGACAGCCCCAAGACAGATGGACTTAGAATAAGGAGAAGCTATATTCCCTCGGGAGCTGA
GGTCAGATTGGCAGGCAGGAAGAGAGGGGACCGGGGTAACGAACCCCTTCTTGCCTCTGTGTTAACAAAA
TGAAAGGGGAAGGGAGGAGATGGGGCTCACTTGGACCAAGGAGTCAAGGGACATAAGGGTGGCCCCGCTG
CCAAGGACATCCTAGCCCTGCTGCTGCAAATCCTTCTCTGCTCCCCATCACCCGGGAGAGAGAAGACATC
CTAACTCCCCCCACCTGGGCCCTGACAGGGCAGTTACCCCCACAGCCCCTTCCTGTGGAGACCAGTCCGA
GGAACCATTTTATTTATTCACCCATATCAAACTAATTTGTTGGGGTGAGGGGAGGAAGGCAGTTGCTCCC
CTACAACCTTTCCAGCGCT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:4502433), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 59389. Forward Primer - name:059389_F_IRAV96_g07_1500016O10Rik, sequence:CAGTGGTGTGGCGACAAG; Reverse Primer - name:059389_R_SP6_IRAV96_g07_1500016O10Rik, sequence:CAGCGCTGGAAAGGTTGT. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:20433 same embryo
 EMAGE:20432 same embryo
 EMAGE:20429 same embryo
 EMAGE:20431 same embryo
 EMAGE:20428 same embryo
 EurExpress:euxassay_012652 same experiment
 MGI:4824748 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS