Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:20483

Accn1 amiloride-sensitive cation channel 1, neuronal (degenerin) ( MGI:1100867)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:20483 EMAGE:20483 EMAGE:20483 EMAGE:20483 EMAGE:20483
"Pseudo-wholemount" of euxassay_012736. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012736_01 euxassay_012736_02 euxassay_012736_03 euxassay_012736_04
EMAGE:20483 EMAGE:20483 EMAGE:20483 EMAGE:20483 EMAGE:20483
euxassay_012736_05 euxassay_012736_06 euxassay_012736_07 euxassay_012736_08 euxassay_012736_09
EMAGE:20483 EMAGE:20483 EMAGE:20483 EMAGE:20483 EMAGE:20483
euxassay_012736_10 euxassay_012736_11 euxassay_012736_12 euxassay_012736_13 euxassay_012736_14
EMAGE:20483 EMAGE:20483 EMAGE:20483 EMAGE:20483 EMAGE:20483
euxassay_012736_15 euxassay_012736_16 euxassay_012736_17 euxassay_012736_18 euxassay_012736_19
EMAGE:20483 EMAGE:20483
euxassay_012736_20 euxassay_012736_21

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:20483Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
20483_wholemount_strong.wlz
20483_wholemount_moderate.wlz
20483_wholemount_weak.wlz
20483_wholemount_possible.wlz
20483_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:20483_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
diencephalon lateral wall mantle layer
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 12 13 14 15
telencephalon mantle layer
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 weak expression: see section 18 19 20 21
medulla oblongata alar plate mantle layer
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13 14 15 16
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13 14 15 16
rest of cerebellum mantle layer
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 weak expression: see section 03
rest of cerebellum marginal layer
moderate moderate
regionalmoderate expression: see section 04
pons mantle layer
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18
midbrain mantle layer
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 12 13 14 15 16
facial vii ganglion
weak weak
regionalweak expression: see section 04 05
glossopharyngeal ix ganglion
weak weak
regionalweak expression: see section 06 16
trigeminal v ganglion
weak weak
regionalweak expression: see section 03 04 05 06 07 08 15 16 17 18 19 20
vagus x ganglion
weak weak
regionalweak expression: see section 07 15
spinal cord mantle layer
moderate moderate
regionalmoderate expression: see section 09 11 12 13
ventral grey horn
moderate moderate
regionalmoderate expression: see section 10
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T38219
Entity Detected:Accn1, amiloride-sensitive cation channel 1, neuronal (degenerin) ( MGI:1100867)
Sequence:sense strand is shown

>T38219
GAAGAAGGCGTATGAAGTTGCTGCCTTACTTGGTGACATTGGTGGTCAAATGGGATTGTTCATTGGTGCT
AGTATCCTTACAATACTAGAGCTCTTTGATTACATTTACGAGCTGATCAAAGAGAAGCTATTAGACCTGC
TTGGCAAAGAAGAAGAGGAAGGGAGCCATGATGAGAACATGAGCACCTGCGACACAATGCCAAACCACTC
CGAAACCATCAGCCACACTGTGAACGTGCCCCTGCAGACAGCTTTGGGCACCCTGGAGGAGATTGCCTGC
TGACACCTCTCAGGCAGCCCAGCACCTCCAAACAGACCTTAAAGGCCCAAGACCCAGGACAGGGGACAGC
AAGCTCAGGTGGCATAGCCCCTGAGGACAGAAAGAAGCAAGAGCCCCCCCATATGCACACATTGCGAACT
TCTGCCAAACCTCACCTGGCCACATCTGACACGAACGGTCCCGGGCCCAGCCTCGTGTCCCTCATAGGAC
CGATGAGTCGCGCTCCGGAACTGTCCAAGAACTAACCTGCCATCACATCTCACTGCCAGATGTACAAAGC
ACCTGCATGCTCAGACTTCTTACAGCGCCGCCTCCACTTCCGTCTTGTACATGATATTTTCTCCGTGCGG
TTTCCGGAGGGAGCCCACTCTGCTACCCAGGCAGTGGGACCAGGTTCCAGACCCAAAGTCACCCTGAGC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 146865. Forward Primer - name:146865_F_cDNA_Accn1, sequence:GAAGAAGGCGTATGAAGTTGCT; Reverse Primer - name:146865_N_SP6_cDNA_Accn1, sequence:GCTCAGGGTGACTTTGGGTCT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:20482 same embryo
 EMAGE:20485 same embryo
 EMAGE:20484 same embryo
 EMAGE:20487 same embryo
 EMAGE:20486 same embryo
 EurExpress:euxassay_012736 same experiment
 MGI:4822912 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS