Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:20604

Rbfox1 RNA binding protein, fox-1 homolog (C. elegans) 1 ( MGI:1926224)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:20604 EMAGE:20604 EMAGE:20604 EMAGE:20604 EMAGE:20604
"Pseudo-wholemount" of euxassay_013824. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_013824_01 euxassay_013824_02 euxassay_013824_03 euxassay_013824_04
EMAGE:20604 EMAGE:20604 EMAGE:20604 EMAGE:20604 EMAGE:20604
euxassay_013824_05 euxassay_013824_06 euxassay_013824_07 euxassay_013824_08 euxassay_013824_09
EMAGE:20604 EMAGE:20604 EMAGE:20604 EMAGE:20604 EMAGE:20604
euxassay_013824_10 euxassay_013824_11 euxassay_013824_12 euxassay_013824_13 euxassay_013824_14
EMAGE:20604 EMAGE:20604 EMAGE:20604 EMAGE:20604 EMAGE:20604
euxassay_013824_15 euxassay_013824_16 euxassay_013824_17 euxassay_013824_18 euxassay_013824_19
EMAGE:20604 EMAGE:20604 EMAGE:20604 EMAGE:20604
euxassay_013824_20 euxassay_013824_21 euxassay_013824_22 euxassay_013824_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:20604Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
20604_wholemount_strong.wlz
20604_wholemount_moderate.wlz
20604_wholemount_weak.wlz
20604_wholemount_possible.wlz
20604_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:20604_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: three stars
Text Annotation:
StructureLevelPatternNotes
hypothalamus mantle layer
strong strong
single cellstrong expression: see section 09 10 11 14 15 16 17 18 19 moderate expression: see section 12 13
diencephalon lateral wall mantle layer
strong strong
single cellstrong expression: see section 08 09 10 11 14 15 16 17 18 19 moderate expression: see section 12 13
cerebral cortex mantle layer
strong strong
single cellstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 14 15 16 17 18 19 20 21 22 23 moderate expression: see section 13
telencephalon mantle layer
strong strong
single cellstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 14 15 16 18 19 20 21 22 23
medulla oblongata basal plate mantle layer
strong strong
single cellstrong expression: see section 08 09 10 11 12 13 14 15 16 17 18
pons mantle layer
strong strong
single cellstrong expression: see section 06 07 08 09 10 11 12 14 15 16 17 18 19 20
midbrain mantle layer
strong strong
single cellstrong expression: see section 07 08 09 10 11 12 13 14 15 16 17 18 19 20
facial vii ganglion
strong strong
single cellstrong expression: see section 04 05 06 07 19 20 21 22
glossopharyngeal ix ganglion
strong strong
single cellstrong expression: see section 07 08 16 17 18
trigeminal v ganglion
strong strong
single cellstrong expression: see section 04 05 06 07 08 17 18 19 20 21 22
trigeminal v nerve
strong strong
single cellstrong expression: see section 09 16 17
spinal cord mantle layer
strong strong
single cellstrong expression: see section 09 10 11 12 13 14
cervico-thoracic ganglion
strong strong
regionalstrong expression: see section 09 16
cervical ganglion
strong strong
regionalstrong expression: see section 16 17
thoracic ganglion
strong strong
regionalstrong expression: see section 11 12
dorsal root ganglion
strong strong
single cellstrong expression: see section 07 08 09 14 15 16 17 18
neural retina
moderate moderate
single cellmoderate expression: see section 01 02 03 04 23
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T38800
Entity Detected:Rbfox1, RNA binding protein, fox-1 homolog (C. elegans) 1 ( MGI:1926224)
Sequence:sense strand is shown

>T38800
GGGGGAATTACTCCCTCTTCTTATCGCGCCAGACCCGGCTGCACCACGGAAGAGTGGGGGCGCTCTGCCA
GCCACAGGACCCACGCGTGCGCCTCGCGGACCCGAGAAACCACCAGTGAGTCGCTCAGCTCGCATCTGGA
GGGGACAGCCGTGCGCCCCGCCCCAGCGTCCGGAGCCGACAACTCCGAGCGTCCTCCCAGCTCAGGACAG
ATCTGAGAGGACCTAGCGCATCTCCAGATCCCGGAAACCCCTGCGCTTCAGACCAGGTGGCCTTGGACAC
CAGGGCCCCTTAGGAGTGATCCGGACCTTCGCCGCGCCCAGTAGTAGGGCGCGGCTGACCTGCCGCGAAG
TTGTGGCCAGCTGGAGTGAGAGAAGCCAACATCCTAATTCGTTGCCTCTGGTGGATGCTGAACGCGGCTG
GGGTCACACAGAGAACTGAGGAATCCAGGAGCAGG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 235832. Forward Primer - name:164987_F_cDNA_A2bp1, sequence:GGGGGAATTACTCCCTCTTCTT; Reverse Primer - name:164987_N_SP6_cDNA_A2bp1, sequence:CCTGCTCCTGGATTCCTCAGT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:20602 same embryo
 EMAGE:20601 same embryo
 EMAGE:20603 same embryo
 EMAGE:20605 same embryo
 EMAGE:20600 same embryo
 EurExpress:euxassay_013824 same experiment
 MGI:4822824 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS