Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:20620

Snhg11 small nucleolar RNA host gene 11 ( MGI:2441845)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:20620 EMAGE:20620 EMAGE:20620 EMAGE:20620 EMAGE:20620
"Pseudo-wholemount" of euxassay_014130. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_014130_01 euxassay_014130_02 euxassay_014130_03 euxassay_014130_04
EMAGE:20620 EMAGE:20620 EMAGE:20620 EMAGE:20620 EMAGE:20620
euxassay_014130_05 euxassay_014130_06 euxassay_014130_07 euxassay_014130_08 euxassay_014130_09
EMAGE:20620 EMAGE:20620 EMAGE:20620 EMAGE:20620 EMAGE:20620
euxassay_014130_10 euxassay_014130_11 euxassay_014130_12 euxassay_014130_13 euxassay_014130_14
EMAGE:20620 EMAGE:20620 EMAGE:20620 EMAGE:20620 EMAGE:20620
euxassay_014130_15 euxassay_014130_16 euxassay_014130_17 euxassay_014130_18 euxassay_014130_19
EMAGE:20620 EMAGE:20620 EMAGE:20620 EMAGE:20620 EMAGE:20620
euxassay_014130_20 euxassay_014130_21 euxassay_014130_22 euxassay_014130_23 euxassay_014130_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:20620Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
20620_wholemount_strong.wlz
20620_wholemount_moderate.wlz
20620_wholemount_weak.wlz
20620_wholemount_possible.wlz
20620_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:20620_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
diencephalon lateral wall mantle layer
strong strong
regionalstrong expression: see section 09 10 11 12 13 14 15 16 17 18 19 20 21 22
telencephalon mantle layer
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
olfactory cortex marginal layer
strong strong
regionalstrong expression: see section 10 11 12 13 14 16 17 18 19
medulla oblongata alar plate mantle layer
strong strong
regionalstrong expression: see section 10 11 12 13 14 15 16 17 18 19 20 21 22 23
medulla oblongata basal plate mantle layer
strong strong
regionalstrong expression: see section 10 11 12 13 14 15 16 17 18 19 20 21 22 23
rest of cerebellum mantle layer
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
pons mantle layer
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
midbrain mantle layer
strong strong
regionalstrong expression: see section 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
facial vii ganglion
strong strong
regionalstrong expression: see section 06 07 08 21 22 23 24
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 09 21 22
trigeminal v ganglion
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 19 20 21 22 23 24
vagus x ganglion
strong strong
regionalstrong expression: see section 09 10 20 21
vestibulocochlear viii ganglion
strong strong
regionalstrong expression: see section 08 09 10 20 21
trigeminal v nerve
strong strong
regionalstrong expression: see section 11 19
spinal cord mantle layer
strong strong
regionalstrong expression: see section 10 11 12 13 14 15 16 17 18 19
dorsal root ganglion
strong strong
regionalstrong expression: see section 09 10 11 12 13 14 15 16 17 18 19 20 21 22
neural retina
strong strong
regionalstrong expression: see section 02 03 04 05
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T40390
Entity Detected:Snhg11, small nucleolar RNA host gene 11 ( MGI:2441845)
Sequence:sense strand is shown

>T40390
GCCAAGGACTGAAAAACAGAAGTGTAGTCGATAGGAGTTAGATTACTTGAAAGTTTCCACCTAAGATTTT
TTTGGTACAGCCTGAGAATAGGTGGGATGTAGTAAGGAATAGAACGGTCCAGAAAGTTCTTCTTCCATGG
AAATGTTATTCTTCGATACTGTTCACATGTTTGTTTTGTTTGCAGTGTCAACCGGACATGTTCTTTCACA
CTCTCGTGGGACAACCCAGTTGTTTCCCACTTC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 76952. Forward Primer - name:076952_F_cDNA_E130013N09Rik, sequence:GCCAAGGACTGAAAAACAGAAG; Reverse Primer - name:076952_N_SP6_cDNA_E130013N09Rik, sequence:GAAGTGGGAAACAACTGGGTT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:MGI:4828349 same experiment
 EurExpress:euxassay_014130 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS