Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:246

Pax1 paired box gene 1 ( MGI:97485)
TS15 (9.5 dpc)
in situ hybridisation

Data Images
EMAGE:246 EMAGE:246
Fig 2A Wallin et al, 1996 [PMID:8565834] . Copyright: This image is from Development and is displayed with the permission of the Company of Biologists Ltd. who owns the copyright. Fig 2B Wallin et al, 1996 [PMID:8565834] . Copyright: This image is from Development and is displayed with the permission of the Company of Biologists Ltd. who owns the copyright.

Expression pattern clarity: three stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Find spatially similar expression patterns: Find spatially similar patterns
Notes:
The whole-mount stained embryo in image A was subsequently sectioned to produce image B. Abbreviations: 1, 2, 3 and 4: the first, second, third and fourth pharyngeal pouch, respectively. These data have been mapped both as 2D wholemount and 3D section data in this EMAGE entry (click on 'Into 3D Framework' and 'Onto Wholemount Picture' in the Expression Mapping page to see both).
Expression Pattern Description
Spatial Annotation:
EMAGE:246EMAGE:246EMAGE:246Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
3D mapping3D context moviewholemount mapping

View mapped 3D expression image EMAGE genex expression entry
Download individual expression domains:
246_wholemount_strong_3D_2.wlz
246_wholemount_moderate_3D_1.wlz
246_wholemount_notDetected_3D_2.wlz
246_voxel_strong_3D_1.wlz
246_voxel_notDetected_3D_1.wlz
(what is wlz format?)
Download all expression domains: EMAGE:246_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Find spatially similar expression patterns: EMAGE spatially similar patterns
Morphological match to the template: three stars
Text Annotation:
StructureLevelPatternNotes
3rd branchial pouch
weak weak
Expression is in the endodermal epithelium.
2nd branchial pouch
detected detected
Expression is in the endodermal epithelium.
1st branchial pouch
detected detected
Expression is in the endodermal epithelium.
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:MGI:1309770
Entity Detected:Pax1, paired box gene 1 ( MGI:97485)
Sequence:sense strand is shown

>MGI:1309770
CAACGGCCGTCCCCTGCCCAATGCCATCCGCCTACGAATCGTGGAGCTAGCACAGCTGGGTATCCGACCC
TGTGACATCAGTAGGCAACTGCGGGTCTCTCATGGCTGCGTGAGCAAAATCCTGGCGCGCTACAACGAGA
CCGGCTCCATCCTGCCCGGGGCCATCGGGGGCAGCAAACCTCGAGTTACCACCCCCAATGTAGTGAAGCA
CATCCGGGACTACAAACAGGGGGATCCTGGCATCTTTGCCTGGGAGATCCGTGACCGGCTACTGGCTGAT
GGCGTTTGTGACAAGTACAACGTGCCCTCTGTGAGCT
nt 291 - nt 607 of NM_008780.1
Notes:The probe used in this study by Wallin et al, 1996 [PMID:8565834] is described as being "generated from a HincII-SacI paired box fragment".
Chemistry:RNA
Strand:antisense
Specimen
Organism:mouse
Age:9.5 dpc
Theiler Stage:TS15
Mutations:none (wild-type)
Preparation:wholemount plus section of wholemount
Procedures
General Information
Authors:Wallin et al, 1996 [PMID:8565834] . Indexed by GXD, Spatially mapped by EMAGE
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ PMID:8565834] Wallin J, Eibel H, Neubuser A, Wilting J, Koseki H, Balling R 1996 Pax1 is expressed during development of the thymus epithelium and is required for normal T-cell maturation. Development (122):23-30
Links:MGI:1333916 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceMGI