Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:2979

Crebbp CREB binding protein ( MGI:1098280)
TS18 (10.5 dpc)
in situ hybridisation

Data Images
EMAGE:2979 EMAGE:2979
1936d1.jpg This embryo was treated with ProteinaseK for either 3min or 30min. 1936d2.jpg This embryo was treated with ProteinaseK for either 3min or 30min.

Expression pattern clarity: one star
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:2979Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
2979_wholemount_strong_3D_1.wlz
2979_wholemount_moderate_3D_1.wlz
2979_wholemount_weak_3D_1.wlz
2979_wholemount_possible_3D_1.wlz
2979_wholemount_notDetected_3D_1.wlz
(what is wlz format?)
Download all expression domains: EMAGE:2979_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
central nervous system
possible possible
Authors stated that in some instances they could not determine expression levels with certainty.
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:MGI:3507155
Entity Detected:Crebbp, CREB binding protein ( MGI:1098280)
Notes:MTF#1936 Original information from the authors, states that a 0.916kb template fragment (corresponding to nt 623-1539 of XM_148699) was PCR amplified from E13.5 or P0 mouse brain, embryonic kidney or testis cDNA using: 5' primer: GGACAGTATTCATTTCTTCCG and 3'primer: GTGCTGATAACAGGCCCAGC. Editor's Note: Pairwise comparison of these primer sequences against all 5 versions of XM_148699 do not match this information (i.e. there is no hit for the 3' primer in XM_148699.1; and the fragment identified in the other 4 versions of XM_148699 is 0.613kb in length (nt916-1529 in XM_148699.2; nt4572-5185 in XM_148699.3; nt4432-5045 in XM_148699.4 and nt4472-5085 in XM_148699.5)). Exact probe sequence is not known.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL
Age:10.5 dpc
Theiler Stage:TS18
Mutations:none (wild-type)
Preparation:wholemount
Procedures
Fixation:4% paraformaldehyde
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Yu J., Tenzen T., Gray P.A., Fu H., Luo P., Zhao Q., Ferrari A., Yuk D.I., Tsung E.F., Cai Z., Alberta J.A., Cheng L.P., Liu Y., Stenman J.M., Valerius M.T., Billings N., Kim H.A., Greenberg M.E., Rowitch D.H., Stiles C.D., Ma Q., McMahon A.P. Indexed by GXD, Spatially mapped by EMAGE.
Principal investigator:Andrew P. McMahon, Molecular and Cellular Biology, Harvard, Department of Molecular and Cellular Biology Harvard University 16 Divinity Ave Room 1059, Cambridge, U.S.A MA 02138
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1126/science.1104935] [ PMID:15618518] Gray PA, 2004 Mouse brain organization revealed through direct genome-scale TF expression analysis. Science (306):2255-7
Acknowledgments:This work was supported by the Charles Dana Foundation, the National Institute of Neurological Disorders and Stroke (QM, CDS, DHR & APM), the National Institute of Dental and Craniofacial Research (QM), the National Institute of Diabetes and Digestive and Kidney Diseases (APM), a Ford Foundation Postdoctoral Fellowship for Minorities (PAG), a Parker B. Francis Fellowship in Pulmonary Medicine (PAG) and the Pew Trust (QM).
Links:MGI:3509944 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEMAGE