Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:3246

Pax1 paired box gene 1 ( MGI:97485)
TS17 (10.5 dpc)
in situ hybridisation

Data Images
EMAGE:3246
Figure 10C of Manley & Capecchi, Development 1995 Jul;121(7):1989-2003 [PMID:7635047] . Copyright: This image is displayed with the permission of The Company of Biologists Limited who owns the Copyright.

Expression pattern clarity: three stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Notes:
Image annotation: pp3 = third pharyngeal pouch.
Expression Pattern Description
Spatial Annotation:
EMAGE:3246Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
3246_wholemount_strong_3D_1.wlz
(what is wlz format?)
Download all expression domains: EMAGE:3246_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
3rd branchial pouch
strong strong
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:MGI:1309770
Entity Detected:Pax1, paired box gene 1 ( MGI:97485)
Sequence:sense strand is shown

>MGI:1309770
CAACGGCCGTCCCCTGCCCAATGCCATCCGCCTACGAATCGTGGAGCTAGCACAGCTGGGTATCCGACCC
TGTGACATCAGTAGGCAACTGCGGGTCTCTCATGGCTGCGTGAGCAAAATCCTGGCGCGCTACAACGAGA
CCGGCTCCATCCTGCCCGGGGCCATCGGGGGCAGCAAACCTCGAGTTACCACCCCCAATGTAGTGAAGCA
CATCCGGGACTACAAACAGGGGGATCCTGGCATCTTTGCCTGGGAGATCCGTGACCGGCTACTGGCTGAT
GGCGTTTGTGACAAGTACAACGTGCCCTCTGTGAGCT
nt 291 - nt 607 of NM_008780.1
Notes:The probe used in this study by Manley & Capecchi, 1995 [PMID:7635047] was either "a 313 base pair HincII-SacI fragment containing the pax-1 paired box (Deutsch et al., 1988 [PMID:2453291] )" or "an 800 base pair cDNA fragment from a BspEI site to the stop codon, containing the entire coding sequence except for the paired box". Both probes gave the same results and were kindly provided by Rudi Balling. Editor's note: The exact sequence of the second probe could not be clarified from this information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:involves: 129S7/SvEvBrd
Age:10.5 dpc
Theiler Stage:TS17
Mutations:Hoxa3tm1Mrc/Hoxa3+
Preparation:wholemount
Procedures
Fixation:4% paraformaldehyde
Staining procedure:alkaline phosphatase + unspecified
General Information
Authors:Manley NR & Capecchi MR, 1995 [PMID:7635047] . Indexed by GXD, Spatially mapped by EMAGE.
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ PMID:7635047] Manley NR, Capecchi MR 1995 The role of Hoxa-3 in mouse thymus and thyroid development. Development (121):1989-2003
 [ doi:10.1016/0092-8674(88)90577-6] [ PMID:2453291] Deutsch U, Dressler GR, Gruss P 1988 Pax 1, a member of a paired box homologous murine gene family, is expressed in segmented structures during development. Cell (53):617-25
Links:MGI:1352843 same experiment
 MGI:1857992 allele description
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceMGI