| Type: | in situ hybridisation probe |
| Identifier: | MGI:1309770 |
| Entity Detected: | Pax1, paired box gene 1 ( MGI:97485) |
| Sequence: | sense strand is shown
>MGI:1309770
CAACGGCCGTCCCCTGCCCAATGCCATCCGCCTACGAATCGTGGAGCTAGCACAGCTGGGTATCCGACCC
TGTGACATCAGTAGGCAACTGCGGGTCTCTCATGGCTGCGTGAGCAAAATCCTGGCGCGCTACAACGAGA
CCGGCTCCATCCTGCCCGGGGCCATCGGGGGCAGCAAACCTCGAGTTACCACCCCCAATGTAGTGAAGCA
CATCCGGGACTACAAACAGGGGGATCCTGGCATCTTTGCCTGGGAGATCCGTGACCGGCTACTGGCTGAT
GGCGTTTGTGACAAGTACAACGTGCCCTCTGTGAGCT
|
| | nt 291 - nt 607 of NM_008780.1 |
| Notes: | The probe used in this study by Manley & Capecchi, 1995 [PMID:7635047] was either "a 313 base pair HincII-SacI fragment containing the pax-1 paired box (Deutsch et al., 1988 [PMID:2453291] )" or "an 800 base pair cDNA fragment from a BspEI site to the stop codon, containing the entire coding sequence except for the paired box". Both probes gave the same results and were kindly provided by Rudi Balling.
Editor's note: The exact sequence of the second probe could not be clarified from this information. |
| Chemistry: | RNA |
| Strand: | antisense |
| Label: | digoxigenin |