Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:3338

Crabp1 cellular retinoic acid binding protein I ( MGI:88490)
TS13 (8.5 dpc)
in situ hybridisation

Data Images
EMAGE:3338
Leonard et al., 1995 [PMID:7729586] . Copyright: Reprinted with permission from Elsevier from [doi:10.1006/dbio.1995.1099] Dev Biol 168: 514-28, Leonard L; Horton C; Maden M; Pizzey JA, Anteriorization of CRABP-I expression by retinoic acid in the developing mouse central nervous system and its relationship to teratogenesis. Copyright 1995

Expression pattern clarity: one star
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:3338Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
3338_wholemount_strong_3D_1.wlz
3338_wholemount_possible_3D_1.wlz
3338_wholemount_notDetected_3D_1.wlz
(what is wlz format?)
Download all expression domains: EMAGE:3338_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
future hindbrain
detected detected
regionalExpression is in a wide stripe adjacent to the preotic sulcus.
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:MGI:1340307
Entity Detected:Crabp1, cellular retinoic acid binding protein I ( MGI:88490)
Sequence:sense strand is shown

>MGI:1340307
AACGCAGCGTGCGACCCGTCCGCAGCAGAGGTGGGTGCCTGCCCCTGCCTTCGCGCCGCCGCTACAGCCA
ACACCA
nt 11 - nt 86 of NM_013496.1
Notes:The Crabp1 probe used in this study by Leonard et al., 1995 [PMID:7729586] was produced using "oligonucleotides designed and synthesized to the 5' end of the murine CRABP-1 gene using published sequence data (Wei et al., 1990 [PMID:2171550] ). The forward and reverse primers used were 5'-AACGCAGCGTGCGACCGCTC-3' and 5'-TGGTGTTGGCTGTAGCGGCG-3'. The amplified 76-bp fragment was cloned into pBlue-script KS plasmid."
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:involves: Swiss * TO
Age:8.5 dpc
Theiler Stage:TS13
Mutations:none (wild-type)
Preparation:wholemount
Procedures
Fixation:4% paraformaldehyde
Staining procedure:alkaline phosphatase + unspecified
General Information
Authors:Leonard L, Horton C, Maden M, Pizzey JA, 1995 [PMID:7729586] . Indexed by GXD, Spatially Mapped by EMAGE
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ doi:10.1006/dbio.1995.1099] [ PMID:7729586] Leonard L, Horton C, Maden M, Pizzey JA 1995 Anteriorization of CRABP-I expression by retinoic acid in the developing mouse central nervous system and its relationship to teratogenesis. Dev Biol (168):514-28
 [ doi:10.1089/dna.1990.9.471] [ PMID:2171550] Wei LN, Tsao JL, Chu YS, Jeannotte L, Nguyen-Huu MC 1990 Molecular cloning and transcriptional mapping of the mouse cellular retinoic acid-binding protein gene. DNA Cell Biol (9):471-8
Links:MGI:1340377 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceMGI